Incidental Mutation 'R5053:Lmnb2'
ID394759
Institutional Source Beutler Lab
Gene Symbol Lmnb2
Ensembl Gene ENSMUSG00000062075
Gene Namelamin B2
Synonymslamin B3
MMRRC Submission 042643-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5053 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80901203-80918245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80904655 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 223 (M223K)
Ref Sequence ENSEMBL: ENSMUSP00000100969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020440] [ENSMUST00000057623] [ENSMUST00000105332] [ENSMUST00000179022] [ENSMUST00000218481] [ENSMUST00000219896]
Predicted Effect probably benign
Transcript: ENSMUST00000020440
SMART Domains Protein: ENSMUSP00000020440
Gene: ENSMUSG00000020219

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:zf-Tim10_DDP 23 87 4.6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000057623
AA Change: M364K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057291
Gene: ENSMUSG00000062075
AA Change: M364K

DomainStartEndE-ValueType
Filament 42 398 1.97e-47 SMART
low complexity region 402 422 N/A INTRINSIC
internal_repeat_1 427 442 1.72e-5 PROSPERO
low complexity region 444 458 N/A INTRINSIC
Pfam:LTD 462 575 9.3e-16 PFAM
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105332
AA Change: M223K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100969
Gene: ENSMUSG00000062075
AA Change: M223K

DomainStartEndE-ValueType
Pfam:Filament 77 257 1.2e-49 PFAM
low complexity region 261 281 N/A INTRINSIC
Pfam:LTD 317 435 6.7e-23 PFAM
low complexity region 438 455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179022
AA Change: M345K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136524
Gene: ENSMUSG00000062075
AA Change: M345K

DomainStartEndE-ValueType
Pfam:Filament 23 379 8.9e-96 PFAM
low complexity region 383 403 N/A INTRINSIC
internal_repeat_1 408 423 1.1e-5 PROSPERO
Pfam:LTD 439 557 1.3e-23 PFAM
low complexity region 560 577 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218149
Predicted Effect probably benign
Transcript: ENSMUST00000218481
Predicted Effect probably benign
Transcript: ENSMUST00000219896
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a B type nuclear lamin. The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Mutations in this gene are associated with acquired partial lipodystrophy. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal death with abnormal brain development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvrl1 A T 15: 101,137,369 I259F probably damaging Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Adsl T C 15: 80,960,450 C180R probably damaging Het
Ahctf1 A G 1: 179,786,784 I448T possibly damaging Het
Alg9 G T 9: 50,788,172 G200W probably damaging Het
Amhr2 G A 15: 102,447,258 V213I probably damaging Het
Ankrd44 A T 1: 54,735,089 L200* probably null Het
As3mt A G 19: 46,709,054 Y87C probably damaging Het
Bcl11a C A 11: 24,164,068 F470L probably benign Het
Cacna2d2 A T 9: 107,514,864 Y468F probably damaging Het
Cep250 A G 2: 155,962,928 D71G possibly damaging Het
Clca4b T C 3: 144,911,121 T923A probably benign Het
Clec16a T C 16: 10,576,597 L273P probably damaging Het
Comtd1 T C 14: 21,847,696 D123G probably damaging Het
Cpa5 A T 6: 30,623,272 E144V probably damaging Het
Cyp2c37 G A 19: 40,001,887 S343N probably benign Het
Dennd6a C A 14: 26,608,583 T103K probably damaging Het
Ect2l A G 10: 18,140,345 L733P probably damaging Het
Erg T A 16: 95,524,534 H11L probably benign Het
Ero1lb T C 13: 12,599,906 L253P probably damaging Het
Etfbkmt T A 6: 149,147,268 L135* probably null Het
Frmd4a A T 2: 4,603,921 T867S probably damaging Het
Gm815 C T 19: 26,886,413 A18V unknown Het
Gna12 C A 5: 140,760,727 R321L probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Irs1 A G 1: 82,286,922 L1191P probably benign Het
Kcp G T 6: 29,496,958 Q551K probably benign Het
Klhl11 C T 11: 100,472,200 V177M probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llcfc1 A G 6: 41,685,335 H91R possibly damaging Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Mme T A 3: 63,364,849 V623E probably damaging Het
Ndc1 T C 4: 107,374,218 S119P probably damaging Het
Nfs1 A C 2: 156,126,398 C383G probably damaging Het
Nphp4 A G 4: 152,544,462 probably null Het
Oca2 C A 7: 56,323,580 Q411K probably benign Het
Olfr1061 A G 2: 86,413,338 F238S probably damaging Het
Olfr1211 C A 2: 88,930,253 V21F probably benign Het
Olfr1377 G A 11: 50,985,310 G203D probably damaging Het
Olfr479 A G 7: 108,055,534 H184R probably benign Het
Olfr748 T A 14: 50,710,511 Y60* probably null Het
Pcdh7 A T 5: 57,721,601 T493S probably damaging Het
Phf20 T C 2: 156,273,862 S368P probably benign Het
Pla2g2e T G 4: 138,880,375 V22G possibly damaging Het
Plxna1 A T 6: 89,322,460 H1736Q probably damaging Het
Prlr C A 15: 10,325,385 Q215K probably benign Het
Prpf6 T C 2: 181,649,453 V687A probably benign Het
Ptprq T A 10: 107,563,202 T1951S probably damaging Het
Sec31a G T 5: 100,393,214 Q345K possibly damaging Het
Serpina3k T C 12: 104,343,214 probably null Het
Sertad3 T A 7: 27,476,522 V127E probably benign Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Shq1 A G 6: 100,655,259 L202P probably damaging Het
Sp8 C T 12: 118,849,604 T398M probably damaging Het
Tmem150c A T 5: 100,083,740 D125E probably benign Het
Trim3 G T 7: 105,617,761 D470E probably damaging Het
Ubap1 T A 4: 41,387,315 C88* probably null Het
Unc79 T A 12: 103,104,748 D1124E probably damaging Het
Usf3 T C 16: 44,217,187 S677P probably benign Het
Vmn1r76 T C 7: 11,930,314 probably null Het
Zfp819 C T 7: 43,617,146 T275I probably damaging Het
Zranb2 T A 3: 157,541,159 D161E probably damaging Het
Other mutations in Lmnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Lmnb2 APN 10 80904037 missense possibly damaging 0.92
IGL00908:Lmnb2 APN 10 80909987 missense probably damaging 0.99
IGL01365:Lmnb2 APN 10 80904984 missense probably benign 0.07
IGL01598:Lmnb2 APN 10 80907165 missense probably benign 0.00
R0761:Lmnb2 UTSW 10 80906254 start codon destroyed probably null 0.03
R1143:Lmnb2 UTSW 10 80904315 unclassified probably benign
R1324:Lmnb2 UTSW 10 80904171 missense possibly damaging 0.60
R1763:Lmnb2 UTSW 10 80907191 missense probably damaging 1.00
R2229:Lmnb2 UTSW 10 80904392 unclassified probably benign
R5001:Lmnb2 UTSW 10 80918112 missense probably damaging 0.98
R5334:Lmnb2 UTSW 10 80903957 missense probably benign 0.08
R5713:Lmnb2 UTSW 10 80906087 missense probably damaging 0.97
R5975:Lmnb2 UTSW 10 80905128 nonsense probably null
R6314:Lmnb2 UTSW 10 80909970 missense probably damaging 1.00
R6835:Lmnb2 UTSW 10 80909960 missense probably damaging 1.00
R7663:Lmnb2 UTSW 10 80904739 missense probably damaging 1.00
R7776:Lmnb2 UTSW 10 80918157 missense possibly damaging 0.52
Z1176:Lmnb2 UTSW 10 80903238 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTTTGAAGCTCTGCCCAGC -3'
(R):5'- CCTCCAAAAGCAGGTGACAG -3'

Sequencing Primer
(F):5'- GCCCAGCCCTCTTTCCTGG -3'
(R):5'- TCAGGGCCTCTGACACTC -3'
Posted On2016-06-15