Incidental Mutation 'R0449:Chd3'
ID39538
Institutional Source Beutler Lab
Gene Symbol Chd3
Ensembl Gene ENSMUSG00000018474
Gene Namechromodomain helicase DNA binding protein 3
SynonymsChd7, Prp7, Mi-2 alpha, 2600010P09Rik, Prp9-1
MMRRC Submission 038649-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0449 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69343273-69369406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69357541 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 748 (V748L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661] [ENSMUST00000144701] [ENSMUST00000154046]
Predicted Effect probably damaging
Transcript: ENSMUST00000092971
AA Change: V842L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474
AA Change: V842L

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 199 253 1.4e-34 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1754 1926 8.6e-104 PFAM
low complexity region 1935 1967 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108661
AA Change: V842L

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474
AA Change: V842L

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 200 253 4.3e-29 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1789 1960 4.9e-93 PFAM
low complexity region 1969 2001 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128981
AA Change: V748L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474
AA Change: V748L

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 55 87 N/A INTRINSIC
Pfam:CHDNT 107 160 3.9e-29 PFAM
low complexity region 164 190 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
low complexity region 305 321 N/A INTRINSIC
PHD 341 384 1.54e-14 SMART
RING 342 383 4.25e-1 SMART
PHD 417 460 1.74e-13 SMART
RING 418 459 3.93e0 SMART
CHROMO 465 544 7.23e-14 SMART
CHROMO 588 637 2.85e-12 SMART
low complexity region 656 662 N/A INTRINSIC
DEXDc 691 903 1.64e-31 SMART
low complexity region 1014 1032 N/A INTRINSIC
HELICc 1049 1133 2.61e-25 SMART
low complexity region 1197 1210 N/A INTRINSIC
DUF1087 1252 1316 2.98e-33 SMART
DUF1086 1322 1478 1.79e-109 SMART
low complexity region 1480 1509 N/A INTRINSIC
low complexity region 1579 1592 N/A INTRINSIC
Pfam:CHDCT2 1662 1833 4.4e-93 PFAM
low complexity region 1842 1874 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144332
Predicted Effect probably benign
Transcript: ENSMUST00000144701
SMART Domains Protein: ENSMUSP00000114520
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
PHD 84 127 1.54e-14 SMART
RING 85 126 4.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151436
SMART Domains Protein: ENSMUSP00000118172
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
Pfam:SNF2_N 1 142 9e-24 PFAM
SCOP:d1gkub2 162 197 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154046
SMART Domains Protein: ENSMUSP00000121192
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
low complexity region 1 29 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
PHD 86 129 1.54e-14 SMART
RING 87 128 4.25e-1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,939,885 R813* probably null Het
Accsl T A 2: 93,866,074 I60F probably benign Het
Adam29 C T 8: 55,872,681 G246D probably benign Het
Ankrd13c A G 3: 157,991,714 I319V probably benign Het
B020004J07Rik T C 4: 101,836,961 S242G probably benign Het
Bag6 T G 17: 35,141,466 V327G probably damaging Het
Barhl1 C T 2: 28,915,292 A130T probably benign Het
Bend4 T C 5: 67,398,240 D541G probably damaging Het
Birc6 A C 17: 74,692,295 T4673P probably damaging Het
Ccdc81 T C 7: 89,890,471 R186G probably damaging Het
Cdyl2 A G 8: 116,583,192 F342L probably damaging Het
CN725425 G T 15: 91,238,944 R72I possibly damaging Het
Col22a1 A G 15: 71,962,671 probably null Het
Cops3 A G 11: 59,818,417 probably null Het
Ctnnd1 G T 2: 84,603,262 Q940K possibly damaging Het
Dtnb C T 12: 3,591,971 Q45* probably null Het
Efr3a T A 15: 65,842,704 I280K probably damaging Het
Eml6 A C 11: 29,893,213 V167G probably benign Het
Fam83c T A 2: 155,830,295 M407L probably benign Het
Fasn T C 11: 120,811,068 T1862A probably benign Het
Fbxl6 A G 15: 76,535,955 I486T probably damaging Het
Gpr182 A G 10: 127,750,696 Y129H probably damaging Het
Gpr75 A G 11: 30,892,456 S454G probably damaging Het
Hectd4 G A 5: 121,364,590 probably null Het
Hsf4 A G 8: 105,275,590 T411A probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il4 A T 11: 53,618,605 M1K probably null Het
Ints11 G T 4: 155,887,948 R463L probably benign Het
Ints4 G A 7: 97,529,223 E677K probably damaging Het
Klk1b11 G A 7: 43,997,792 C50Y probably damaging Het
Krt14 C A 11: 100,207,395 G21C unknown Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Lama3 A G 18: 12,500,512 probably null Het
Lrrk2 T C 15: 91,750,275 L1414P probably damaging Het
Matn2 T C 15: 34,428,541 S684P probably damaging Het
Mga T A 2: 119,941,381 V1574D probably damaging Het
Mia2 T C 12: 59,172,594 probably null Het
Mrpl21 T A 19: 3,292,459 probably benign Het
Msh5 T A 17: 35,041,482 Q266L probably benign Het
Mybpc1 C A 10: 88,540,960 C758F probably damaging Het
Myo15 G A 11: 60,509,596 A2932T possibly damaging Het
Nbas T A 12: 13,519,108 I2021K probably benign Het
Neurl4 T C 11: 69,905,567 S424P probably damaging Het
Olfr16 T A 1: 172,957,398 V201E probably damaging Het
Olfr322 A C 11: 58,665,963 I135L probably benign Het
Olfr782 A G 10: 129,351,234 M224V probably benign Het
Olfr829 T C 9: 18,856,649 M8T probably benign Het
Olfr850 T A 9: 19,478,092 I53F possibly damaging Het
Phlpp1 C T 1: 106,350,578 R907W probably damaging Het
Pigg T C 5: 108,336,411 V508A probably benign Het
Pkhd1l1 T G 15: 44,501,519 Y685D probably damaging Het
Polr3a A T 14: 24,484,466 I34N probably damaging Het
Prex1 A G 2: 166,569,377 V1434A probably benign Het
Ptprh T A 7: 4,598,006 D124V probably damaging Het
Rad54b T A 4: 11,606,131 I513N probably benign Het
Rbm12b1 A G 4: 12,145,507 N493S probably benign Het
Rfx7 A T 9: 72,610,304 probably null Het
Serpini1 A G 3: 75,613,341 K82E probably benign Het
Slc27a6 T G 18: 58,609,165 probably null Het
Slc35f2 G T 9: 53,816,917 L358F probably damaging Het
Slc45a1 A C 4: 150,643,305 I158M probably damaging Het
Slurp2 G A 15: 74,743,106 P62L probably damaging Het
Sspo C T 6: 48,466,740 H1949Y probably damaging Het
Tiam1 A T 16: 89,837,827 V865E possibly damaging Het
Tlr4 A C 4: 66,839,620 I217L probably damaging Het
Top1 C T 2: 160,712,708 R460* probably null Het
Trpm3 T A 19: 22,988,054 S1638T probably benign Het
Tubgcp5 C T 7: 55,823,567 R798C probably benign Het
Vars T G 17: 35,012,727 probably null Het
Xylt2 A G 11: 94,666,333 Y111H probably benign Het
Zbed5 G A 5: 129,901,726 G172D probably damaging Het
Zfp53 C T 17: 21,508,833 T376I probably benign Het
Zfp937 G T 2: 150,239,546 V499L probably benign Het
Zyx T A 6: 42,351,313 L152Q probably damaging Het
Other mutations in Chd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Chd3 APN 11 69357062 missense probably damaging 0.96
IGL00551:Chd3 APN 11 69346629 missense probably damaging 1.00
IGL00661:Chd3 APN 11 69357383 missense possibly damaging 0.84
IGL00698:Chd3 APN 11 69349871 missense probably damaging 0.98
IGL01075:Chd3 APN 11 69359965 missense probably damaging 1.00
IGL01309:Chd3 APN 11 69357731 missense probably damaging 0.99
IGL01317:Chd3 APN 11 69353211 missense probably damaging 1.00
IGL01374:Chd3 APN 11 69359980 missense probably damaging 0.99
IGL01444:Chd3 APN 11 69348742 missense probably benign 0.28
IGL01617:Chd3 APN 11 69358234 unclassified probably benign
IGL01635:Chd3 APN 11 69361250 splice site probably benign
IGL01942:Chd3 APN 11 69350105 critical splice donor site probably null
IGL01962:Chd3 APN 11 69357493 missense possibly damaging 0.46
IGL01981:Chd3 APN 11 69360675 missense probably damaging 0.99
IGL02022:Chd3 APN 11 69361060 missense probably damaging 1.00
IGL02098:Chd3 APN 11 69359829 missense probably damaging 1.00
IGL02218:Chd3 APN 11 69352094 unclassified probably benign
IGL02415:Chd3 APN 11 69348913 splice site probably benign
IGL02648:Chd3 APN 11 69352150 missense probably damaging 1.00
IGL02951:Chd3 APN 11 69361048 critical splice donor site probably null
IGL03030:Chd3 APN 11 69354404 missense possibly damaging 0.64
IGL03102:Chd3 APN 11 69361196 nonsense probably null
IGL03168:Chd3 APN 11 69348915 splice site probably benign
IGL03327:Chd3 APN 11 69350186 missense probably damaging 1.00
burg UTSW 11 69356554 missense probably damaging 1.00
Fortress UTSW 11 69364050 nonsense probably null
Redoubt UTSW 11 69353901 unclassified probably benign
schloss UTSW 11 69362060 nonsense probably null
R0009:Chd3 UTSW 11 69349906 missense probably damaging 0.99
R0009:Chd3 UTSW 11 69349906 missense probably damaging 0.99
R0056:Chd3 UTSW 11 69359913 unclassified probably benign
R0129:Chd3 UTSW 11 69348501 nonsense probably null
R0130:Chd3 UTSW 11 69359830 missense probably damaging 1.00
R0309:Chd3 UTSW 11 69357018 missense probably damaging 1.00
R0330:Chd3 UTSW 11 69356333 missense probably damaging 1.00
R0502:Chd3 UTSW 11 69354105 missense probably damaging 0.98
R0540:Chd3 UTSW 11 69344358 missense probably damaging 0.98
R0571:Chd3 UTSW 11 69361669 critical splice donor site probably null
R0607:Chd3 UTSW 11 69344358 missense probably damaging 0.98
R0616:Chd3 UTSW 11 69345487 missense probably damaging 0.96
R0630:Chd3 UTSW 11 69347195 missense probably damaging 1.00
R1436:Chd3 UTSW 11 69357574 splice site probably null
R1484:Chd3 UTSW 11 69359899 missense probably benign 0.17
R1741:Chd3 UTSW 11 69355654 missense probably damaging 1.00
R1748:Chd3 UTSW 11 69364697 missense possibly damaging 0.81
R1751:Chd3 UTSW 11 69353901 unclassified probably benign
R1833:Chd3 UTSW 11 69354123 missense probably damaging 1.00
R2012:Chd3 UTSW 11 69349052 missense probably benign 0.01
R2101:Chd3 UTSW 11 69349051 missense probably benign
R2147:Chd3 UTSW 11 69349028 missense probably benign 0.00
R2513:Chd3 UTSW 11 69360645 missense probably damaging 1.00
R2877:Chd3 UTSW 11 69361172 nonsense probably null
R2879:Chd3 UTSW 11 69364098 missense possibly damaging 0.52
R2880:Chd3 UTSW 11 69352120 missense probably damaging 1.00
R2881:Chd3 UTSW 11 69352120 missense probably damaging 1.00
R2973:Chd3 UTSW 11 69360616 missense probably damaging 1.00
R3611:Chd3 UTSW 11 69362147 missense possibly damaging 0.53
R3743:Chd3 UTSW 11 69364050 nonsense probably null
R3845:Chd3 UTSW 11 69346759 missense possibly damaging 0.65
R3889:Chd3 UTSW 11 69359185 missense probably damaging 0.98
R4007:Chd3 UTSW 11 69349001 missense probably benign
R4115:Chd3 UTSW 11 69357517 missense possibly damaging 0.95
R4515:Chd3 UTSW 11 69349877 missense probably benign 0.00
R4612:Chd3 UTSW 11 69353209 nonsense probably null
R4622:Chd3 UTSW 11 69349008 missense probably damaging 0.98
R4634:Chd3 UTSW 11 69362187 unclassified probably benign
R4635:Chd3 UTSW 11 69362187 unclassified probably benign
R4859:Chd3 UTSW 11 69359896 missense possibly damaging 0.79
R4930:Chd3 UTSW 11 69354208 unclassified probably benign
R5173:Chd3 UTSW 11 69369243 unclassified probably benign
R5287:Chd3 UTSW 11 69349069 splice site probably null
R5403:Chd3 UTSW 11 69349069 splice site probably null
R5511:Chd3 UTSW 11 69361475 missense probably damaging 1.00
R5666:Chd3 UTSW 11 69353351 missense possibly damaging 0.83
R5702:Chd3 UTSW 11 69361435 missense possibly damaging 0.46
R6045:Chd3 UTSW 11 69352118 missense possibly damaging 0.90
R6063:Chd3 UTSW 11 69349237 missense probably benign
R6211:Chd3 UTSW 11 69352677 missense probably damaging 1.00
R6215:Chd3 UTSW 11 69356554 missense probably damaging 1.00
R6217:Chd3 UTSW 11 69345535 missense probably damaging 1.00
R6302:Chd3 UTSW 11 69353778 missense probably damaging 0.98
R6329:Chd3 UTSW 11 69361684 missense possibly damaging 0.70
R6349:Chd3 UTSW 11 69364031 missense possibly damaging 0.50
R6414:Chd3 UTSW 11 69352545 critical splice donor site probably null
R6453:Chd3 UTSW 11 69350112 nonsense probably null
R6548:Chd3 UTSW 11 69362060 nonsense probably null
R6582:Chd3 UTSW 11 69369156 unclassified probably benign
R6721:Chd3 UTSW 11 69369219 unclassified probably benign
R6776:Chd3 UTSW 11 69354470 missense probably damaging 1.00
R6900:Chd3 UTSW 11 69354445 missense possibly damaging 0.64
R7085:Chd3 UTSW 11 69369201 missense unknown
R7136:Chd3 UTSW 11 69348438 missense probably null 0.37
R7164:Chd3 UTSW 11 69362306 missense probably damaging 1.00
R7200:Chd3 UTSW 11 69364095 missense possibly damaging 0.94
R7226:Chd3 UTSW 11 69369211 missense unknown
R7238:Chd3 UTSW 11 69364047 missense probably benign 0.31
R7316:Chd3 UTSW 11 69345568 missense probably damaging 0.99
R7560:Chd3 UTSW 11 69356270 missense probably damaging 1.00
R7684:Chd3 UTSW 11 69357866 missense possibly damaging 0.83
R7748:Chd3 UTSW 11 69355633 missense probably benign 0.00
R7820:Chd3 UTSW 11 69353238 missense probably damaging 1.00
R7885:Chd3 UTSW 11 69356625 missense probably benign 0.13
R8150:Chd3 UTSW 11 69363684 missense probably benign 0.02
R8161:Chd3 UTSW 11 69350885 missense probably damaging 1.00
R8271:Chd3 UTSW 11 69360657 missense probably damaging 1.00
X0022:Chd3 UTSW 11 69356258 missense probably damaging 1.00
X0062:Chd3 UTSW 11 69354445 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGCTGATAGAGCTGCACTTGCTCC -3'
(R):5'- GAGACTCAGCCAAGGTTCATCACAG -3'

Sequencing Primer
(F):5'- TCTACTGTGGAGTACAGAGCC -3'
(R):5'- GGCACACTGCACATGTATCAG -3'
Posted On2013-05-23