Incidental Mutation 'R5158:Sec31a'
ID 396828
Institutional Source Beutler Lab
Gene Symbol Sec31a
Ensembl Gene ENSMUSG00000035325
Gene Name SEC31 homolog A, COPII coat complex component
Synonyms 1810024J13Rik, Sec31l1
MMRRC Submission 042740-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.855) question?
Stock # R5158 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 100509508-100564093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 100541180 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 309 (I309N)
Ref Sequence ENSEMBL: ENSMUSP00000138213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094578] [ENSMUST00000182886] [ENSMUST00000183247]
AlphaFold Q3UPL0
Predicted Effect probably damaging
Transcript: ENSMUST00000094578
AA Change: I309N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092157
Gene: ENSMUSG00000035325
AA Change: I309N

DomainStartEndE-ValueType
WD40 56 102 1.59e1 SMART
WD40 111 151 5.15e-2 SMART
WD40 158 197 5.16e-1 SMART
WD40 200 245 6.63e0 SMART
WD40 249 289 1.95e-2 SMART
WD40 292 332 4.24e-3 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 572 769 3.5e-7 PFAM
low complexity region 866 882 N/A INTRINSIC
low complexity region 930 949 N/A INTRINSIC
low complexity region 953 975 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182886
AA Change: I309N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138213
Gene: ENSMUSG00000035325
AA Change: I309N

DomainStartEndE-ValueType
WD40 56 102 1e-1 SMART
WD40 111 151 3.3e-4 SMART
WD40 158 197 3.2e-3 SMART
WD40 200 245 4.1e-2 SMART
WD40 249 289 1.2e-4 SMART
WD40 292 332 2.6e-5 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 532 731 2.1e-6 PFAM
low complexity region 827 843 N/A INTRINSIC
low complexity region 891 910 N/A INTRINSIC
low complexity region 914 936 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182988
AA Change: I48N
Predicted Effect probably benign
Transcript: ENSMUST00000183247
SMART Domains Protein: ENSMUSP00000138129
Gene: ENSMUSG00000035325

DomainStartEndE-ValueType
Pfam:Sec16_C 141 248 1.5e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(31) : Gene trapped(31)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 C T 17: 45,825,755 (GRCm39) T357I probably benign Het
Abca14 A T 7: 119,852,652 (GRCm39) R872S probably benign Het
Adnp2 A G 18: 80,180,758 (GRCm39) Y47H probably damaging Het
Atp6v0d2 T C 4: 19,878,292 (GRCm39) N327S probably damaging Het
Ccdc190 A G 1: 169,760,578 (GRCm39) R69G probably benign Het
Cfap54 T C 10: 92,901,059 (GRCm39) D213G probably damaging Het
Clcn4 G A 7: 7,294,618 (GRCm39) T381I possibly damaging Het
Cobl A G 11: 12,206,198 (GRCm39) F477S possibly damaging Het
Ctdspl2 T A 2: 121,811,774 (GRCm39) V205E probably benign Het
Dhx37 A T 5: 125,492,216 (GRCm39) Y1128N probably damaging Het
Ehmt2 G A 17: 35,130,640 (GRCm39) E1085K probably damaging Het
Fam149a T G 8: 45,803,472 (GRCm39) I340L possibly damaging Het
Fut9 T A 4: 25,620,731 (GRCm39) I28F probably benign Het
Il36g T A 2: 24,082,798 (GRCm39) I191K probably damaging Het
Iqgap1 T C 7: 80,392,816 (GRCm39) N716D probably benign Het
Itgb7 T C 15: 102,125,464 (GRCm39) D672G probably benign Het
Kat6b A G 14: 21,720,054 (GRCm39) M1469V possibly damaging Het
Kif3a T C 11: 53,479,578 (GRCm39) F430L probably benign Het
L3mbtl3 T C 10: 26,179,586 (GRCm39) D523G unknown Het
Mcf2l A G 8: 13,059,715 (GRCm39) Q736R probably damaging Het
Mpl T G 4: 118,313,881 (GRCm39) D128A probably damaging Het
Myom3 T A 4: 135,492,897 (GRCm39) C149S probably damaging Het
N4bp2 A G 5: 65,965,805 (GRCm39) I1285V probably damaging Het
Nalcn T C 14: 123,753,149 (GRCm39) Q279R probably damaging Het
Ndc1 T G 4: 107,232,362 (GRCm39) S182R probably damaging Het
Ngf A T 3: 102,427,445 (GRCm39) M65L possibly damaging Het
Or2n1 T A 17: 38,486,345 (GRCm39) Y123* probably null Het
Pigb T C 9: 72,929,683 (GRCm39) Y300C probably damaging Het
Pla2g2a T G 4: 138,560,595 (GRCm39) *69G probably null Het
Ppp1r12b T C 1: 134,814,166 (GRCm39) E379G probably damaging Het
Ptdss2 T C 7: 140,731,684 (GRCm39) F164S probably benign Het
Ptprc T C 1: 138,102,822 (GRCm39) T2A possibly damaging Het
Ptprq T A 10: 107,370,565 (GRCm39) N2042I probably damaging Het
Rdh10 A T 1: 16,178,221 (GRCm39) R164S probably damaging Het
Skint5 A T 4: 113,599,409 (GRCm39) I710N unknown Het
Slc25a30 A T 14: 76,008,956 (GRCm39) L26Q probably damaging Het
Sptan1 G A 2: 29,868,455 (GRCm39) V34I probably damaging Het
Sult1e1 A T 5: 87,735,453 (GRCm39) I75N probably damaging Het
Trpa1 A G 1: 14,951,885 (GRCm39) V938A probably benign Het
Vps16 C T 2: 130,283,199 (GRCm39) R531C probably damaging Het
Zbtb22 C T 17: 34,137,423 (GRCm39) H523Y probably damaging Het
Zfp39 G A 11: 58,780,671 (GRCm39) T697M possibly damaging Het
Other mutations in Sec31a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Sec31a APN 5 100,551,876 (GRCm39) nonsense probably null
IGL01610:Sec31a APN 5 100,550,217 (GRCm39) splice site probably benign
IGL01804:Sec31a APN 5 100,523,065 (GRCm39) critical splice donor site probably null
IGL02026:Sec31a APN 5 100,517,485 (GRCm39) missense probably benign 0.04
IGL02150:Sec31a APN 5 100,533,984 (GRCm39) splice site probably benign
IGL02237:Sec31a APN 5 100,509,914 (GRCm39) missense probably damaging 1.00
IGL02469:Sec31a APN 5 100,533,114 (GRCm39) missense probably benign 0.02
IGL02512:Sec31a APN 5 100,555,052 (GRCm39) missense probably damaging 0.99
control UTSW 5 100,510,032 (GRCm39) missense probably damaging 1.00
D3080:Sec31a UTSW 5 100,511,691 (GRCm39) missense probably damaging 1.00
PIT4142001:Sec31a UTSW 5 100,555,134 (GRCm39) missense probably damaging 1.00
R0366:Sec31a UTSW 5 100,530,625 (GRCm39) missense probably damaging 1.00
R0453:Sec31a UTSW 5 100,551,977 (GRCm39) splice site probably benign
R0511:Sec31a UTSW 5 100,523,099 (GRCm39) missense probably benign 0.01
R0546:Sec31a UTSW 5 100,551,929 (GRCm39) missense probably damaging 1.00
R0675:Sec31a UTSW 5 100,541,066 (GRCm39) missense probably damaging 0.97
R0678:Sec31a UTSW 5 100,555,084 (GRCm39) missense possibly damaging 0.74
R0975:Sec31a UTSW 5 100,543,763 (GRCm39) splice site probably null
R1146:Sec31a UTSW 5 100,510,032 (GRCm39) missense probably damaging 1.00
R1146:Sec31a UTSW 5 100,510,032 (GRCm39) missense probably damaging 1.00
R1540:Sec31a UTSW 5 100,523,178 (GRCm39) missense probably damaging 1.00
R1616:Sec31a UTSW 5 100,534,054 (GRCm39) missense possibly damaging 0.88
R1780:Sec31a UTSW 5 100,529,195 (GRCm39) splice site probably null
R2472:Sec31a UTSW 5 100,533,064 (GRCm39) missense probably damaging 1.00
R3689:Sec31a UTSW 5 100,530,766 (GRCm39) missense probably damaging 1.00
R4515:Sec31a UTSW 5 100,513,817 (GRCm39) missense probably damaging 0.99
R4801:Sec31a UTSW 5 100,541,222 (GRCm39) missense probably damaging 0.96
R4802:Sec31a UTSW 5 100,541,222 (GRCm39) missense probably damaging 0.96
R4896:Sec31a UTSW 5 100,516,192 (GRCm39) missense probably damaging 1.00
R5004:Sec31a UTSW 5 100,516,192 (GRCm39) missense probably damaging 1.00
R5053:Sec31a UTSW 5 100,541,073 (GRCm39) missense possibly damaging 0.94
R5191:Sec31a UTSW 5 100,553,370 (GRCm39) missense possibly damaging 0.75
R5222:Sec31a UTSW 5 100,530,754 (GRCm39) missense probably benign
R5405:Sec31a UTSW 5 100,531,657 (GRCm39) nonsense probably null
R5436:Sec31a UTSW 5 100,511,698 (GRCm39) missense probably damaging 0.98
R5577:Sec31a UTSW 5 100,550,133 (GRCm39) missense possibly damaging 0.95
R6005:Sec31a UTSW 5 100,511,737 (GRCm39) missense probably damaging 1.00
R6184:Sec31a UTSW 5 100,517,453 (GRCm39) critical splice donor site probably null
R6245:Sec31a UTSW 5 100,534,043 (GRCm39) missense probably benign 0.07
R6475:Sec31a UTSW 5 100,533,129 (GRCm39) missense probably damaging 1.00
R6476:Sec31a UTSW 5 100,534,008 (GRCm39) missense probably benign 0.03
R6744:Sec31a UTSW 5 100,540,358 (GRCm39) missense possibly damaging 0.47
R6804:Sec31a UTSW 5 100,530,671 (GRCm39) missense probably benign 0.03
R6911:Sec31a UTSW 5 100,541,123 (GRCm39) missense possibly damaging 0.92
R6936:Sec31a UTSW 5 100,540,369 (GRCm39) missense probably benign
R7345:Sec31a UTSW 5 100,533,129 (GRCm39) missense probably damaging 1.00
R7760:Sec31a UTSW 5 100,540,487 (GRCm39) missense probably damaging 1.00
R7898:Sec31a UTSW 5 100,547,336 (GRCm39) missense probably damaging 0.99
R8088:Sec31a UTSW 5 100,526,721 (GRCm39) missense
R8555:Sec31a UTSW 5 100,540,273 (GRCm39) missense probably benign 0.25
R8762:Sec31a UTSW 5 100,526,688 (GRCm39) missense
R9055:Sec31a UTSW 5 100,534,040 (GRCm39) missense possibly damaging 0.75
R9173:Sec31a UTSW 5 100,529,147 (GRCm39) missense possibly damaging 0.85
R9249:Sec31a UTSW 5 100,533,083 (GRCm39) missense probably damaging 0.98
X0003:Sec31a UTSW 5 100,547,213 (GRCm39) missense probably damaging 0.98
Z1177:Sec31a UTSW 5 100,531,704 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCTATCTTTCTCGGTCG -3'
(R):5'- ACTGAGTAGCACTCCTGTCC -3'

Sequencing Primer
(F):5'- TTTCTCGGTCGCAACCATCAAAAG -3'
(R):5'- TCACTGTGCTGTACGGAGAAC -3'
Posted On 2016-06-21