Incidental Mutation 'R8088:Sec31a'
ID629782
Institutional Source Beutler Lab
Gene Symbol Sec31a
Ensembl Gene ENSMUSG00000035325
Gene NameSec31 homolog A (S. cerevisiae)
SynonymsSec31l1, 1810024J13Rik
Accession Numbers

Genbank: NM_026969; MGI: 1916412; Ensembl: ENSMUST00000046296, ENSMUST00000094578, ENSMUST00000112918

Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R8088 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location100361649-100416234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100378862 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 46 (M46K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094578] [ENSMUST00000182886] [ENSMUST00000183247]
Predicted Effect probably benign
Transcript: ENSMUST00000094578
AA Change: M822K

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000092157
Gene: ENSMUSG00000035325
AA Change: M822K

DomainStartEndE-ValueType
WD40 56 102 1.59e1 SMART
WD40 111 151 5.15e-2 SMART
WD40 158 197 5.16e-1 SMART
WD40 200 245 6.63e0 SMART
WD40 249 289 1.95e-2 SMART
WD40 292 332 4.24e-3 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 572 769 3.5e-7 PFAM
low complexity region 866 882 N/A INTRINSIC
low complexity region 930 949 N/A INTRINSIC
low complexity region 953 975 N/A INTRINSIC
Predicted Effect
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000182886
AA Change: M783K

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138213
Gene: ENSMUSG00000035325
AA Change: M783K

DomainStartEndE-ValueType
WD40 56 102 1e-1 SMART
WD40 111 151 3.3e-4 SMART
WD40 158 197 3.2e-3 SMART
WD40 200 245 4.1e-2 SMART
WD40 249 289 1.2e-4 SMART
WD40 292 332 2.6e-5 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 532 731 2.1e-6 PFAM
low complexity region 827 843 N/A INTRINSIC
low complexity region 891 910 N/A INTRINSIC
low complexity region 914 936 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000183247
SMART Domains Protein: ENSMUSP00000138129
Gene: ENSMUSG00000035325

DomainStartEndE-ValueType
Pfam:Sec16_C 141 248 1.5e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.1%
  • 20x: 96.8%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(31) : Gene trapped(31)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,318 M453V probably benign Het
Atp2c1 A T 9: 105,452,569 probably null Het
Ccdc134 T A 15: 82,131,789 probably benign Het
Ccdc162 G T 10: 41,623,414 H1066Q possibly damaging Het
Ccna1 A G 3: 55,051,071 S64P probably benign Het
Defb12 T C 8: 19,112,821 probably null Het
Dhx9 C A 1: 153,462,697 V738L probably benign Het
Dnah10 A G 5: 124,754,266 N843S probably benign Het
Dspp A G 5: 104,177,256 D495G unknown Het
Dus2 A G 8: 106,030,441 M88V probably benign Het
Dusp13 A G 14: 21,741,237 V49A probably benign Het
Ehbp1 G A 11: 22,089,572 H843Y probably null Het
Entpd3 A C 9: 120,554,173 R91S probably benign Het
Fam207a T C 10: 77,514,395 N53S probably benign Het
Fam83c C A 2: 155,831,639 V210F probably damaging Het
Flot1 G A 17: 35,829,978 A287T probably damaging Het
Gm11639 A T 11: 104,998,246 I4163L probably benign Het
Gm19410 A G 8: 35,806,841 K1412E probably benign Het
Gsn G A 2: 35,292,647 V241M possibly damaging Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Heatr5a T C 12: 51,947,996 D451G possibly damaging Het
Hmcn2 G A 2: 31,426,903 W3831* probably null Het
Il3 A G 11: 54,265,549 V119A probably benign Het
Jam3 T C 9: 27,098,860 K276R probably benign Het
Kcnt1 G A 2: 25,894,314 G277D possibly damaging Het
Kif28 T A 1: 179,700,354 D744V probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Loxhd1 T C 18: 77,342,013 I535T possibly damaging Het
Lzts1 A C 8: 69,135,822 L494R probably benign Het
Mettl4 A G 17: 94,735,367 V347A probably damaging Het
Mff A G 1: 82,751,649 E270G probably damaging Het
Mroh2b A T 15: 4,900,503 I24F possibly damaging Het
Muc16 A T 9: 18,519,300 Y8102* probably null Het
Myh14 A T 7: 44,665,496 M1K probably null Het
Myo18b T A 5: 112,879,510 probably benign Het
Neurl1a C A 19: 47,257,434 P502T probably damaging Het
Nrp1 G A 8: 128,468,516 W484* probably null Het
Olfr131 T A 17: 38,082,561 H139L possibly damaging Het
Olfr1317 T A 2: 112,142,257 I104N probably benign Het
Pcdhac1 T C 18: 37,091,754 V540A possibly damaging Het
Pcdhga9 A G 18: 37,736,954 probably benign Het
Pm20d1 A C 1: 131,801,763 N176T probably benign Het
Pnldc1 T C 17: 12,897,302 D271G probably damaging Het
Pold3 A G 7: 100,112,301 V63A probably damaging Het
Rbm18 A C 2: 36,127,184 S61A probably benign Het
Rdh14 T C 12: 10,394,551 L134P probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rtel1 A G 2: 181,322,345 T46A probably damaging Het
Rtn3 T C 19: 7,434,998 I823V probably damaging Het
S1pr1 A G 3: 115,712,034 S304P probably damaging Het
Scfd2 A G 5: 74,531,363 V86A probably benign Het
Scgb1a1 C T 19: 9,085,235 V66M probably damaging Het
Sgsm1 A G 5: 113,255,268 M971T probably damaging Het
Slc5a11 T C 7: 123,265,728 I419T probably benign Het
Slco6d1 A T 1: 98,466,706 T372S possibly damaging Het
Spata31 T A 13: 64,920,865 Y276N probably benign Het
Sprr2k C T 3: 92,433,489 R49W unknown Het
Sspo G A 6: 48,457,613 C1013Y probably damaging Het
Ssr2 A G 3: 88,579,883 R2G possibly damaging Het
St18 C A 1: 6,828,005 T677K probably benign Het
Thap11 A T 8: 105,855,895 I179F probably damaging Het
Trf C A 9: 103,211,931 G586C probably damaging Het
Umodl1 A G 17: 30,973,796 N299S probably benign Het
Xrcc5 C A 1: 72,312,436 A55E probably damaging Het
Other mutations in Sec31a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Sec31a APN 5 100404017 nonsense probably null
IGL01610:Sec31a APN 5 100402358 splice site probably benign
IGL01804:Sec31a APN 5 100375206 critical splice donor site probably null
IGL02026:Sec31a APN 5 100369626 missense probably benign 0.04
IGL02150:Sec31a APN 5 100386125 splice site probably benign
IGL02237:Sec31a APN 5 100362055 missense probably damaging 1.00
IGL02469:Sec31a APN 5 100385255 missense probably benign 0.02
IGL02512:Sec31a APN 5 100407193 missense probably damaging 0.99
control UTSW 5 100362173 missense probably damaging 1.00
Discipline UTSW 5 100363878 missense probably damaging 1.00
D3080:Sec31a UTSW 5 100363832 missense probably damaging 1.00
PIT4142001:Sec31a UTSW 5 100407275 missense probably damaging 1.00
R0366:Sec31a UTSW 5 100382766 missense probably damaging 1.00
R0453:Sec31a UTSW 5 100404118 splice site probably benign
R0511:Sec31a UTSW 5 100375240 missense probably benign 0.01
R0546:Sec31a UTSW 5 100404070 missense probably damaging 1.00
R0675:Sec31a UTSW 5 100393207 missense probably damaging 0.97
R0678:Sec31a UTSW 5 100407225 missense possibly damaging 0.74
R0975:Sec31a UTSW 5 100395904 unclassified probably null
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1540:Sec31a UTSW 5 100375319 missense probably damaging 1.00
R1616:Sec31a UTSW 5 100386195 missense possibly damaging 0.88
R1780:Sec31a UTSW 5 100381336 splice site probably null
R2472:Sec31a UTSW 5 100385205 missense probably damaging 1.00
R3689:Sec31a UTSW 5 100382907 missense probably damaging 1.00
R4515:Sec31a UTSW 5 100365958 missense probably damaging 0.99
R4801:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4802:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4896:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5004:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5053:Sec31a UTSW 5 100393214 missense possibly damaging 0.94
R5158:Sec31a UTSW 5 100393321 missense probably damaging 0.99
R5191:Sec31a UTSW 5 100405511 missense possibly damaging 0.75
R5222:Sec31a UTSW 5 100382895 missense probably benign
R5405:Sec31a UTSW 5 100383798 nonsense probably null
R5436:Sec31a UTSW 5 100363839 missense probably damaging 0.98
R5577:Sec31a UTSW 5 100402274 missense possibly damaging 0.95
R6005:Sec31a UTSW 5 100363878 missense probably damaging 1.00
R6184:Sec31a UTSW 5 100369594 critical splice donor site probably null
R6245:Sec31a UTSW 5 100386184 missense probably benign 0.07
R6475:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R6476:Sec31a UTSW 5 100386149 missense probably benign 0.03
R6744:Sec31a UTSW 5 100392499 missense possibly damaging 0.47
R6804:Sec31a UTSW 5 100382812 missense probably benign 0.03
R6911:Sec31a UTSW 5 100393264 missense possibly damaging 0.92
R6936:Sec31a UTSW 5 100392510 missense probably benign
R7345:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R7760:Sec31a UTSW 5 100392628 missense probably damaging 1.00
R7898:Sec31a UTSW 5 100399477 missense probably damaging 0.99
X0003:Sec31a UTSW 5 100399354 missense probably damaging 0.98
Z1177:Sec31a UTSW 5 100383845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCCACTGAGTGCAACTG -3'
(R):5'- TTGAAGGGATCTCTTGAATGATCAG -3'

Sequencing Primer
(F):5'- AACTGCGGCACACTCTG -3'
(R):5'- CATAGCTGGCTCAATTCACAG -3'
Posted On2020-06-30