Incidental Mutation 'R5264:Paqr8'
ID401575
Institutional Source Beutler Lab
Gene Symbol Paqr8
Ensembl Gene ENSMUSG00000025931
Gene Nameprogestin and adipoQ receptor family member VIII
Synonyms1700019B16Rik, 3110001D06Rik
MMRRC Submission 042832-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5264 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location20890606-20939650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20935108 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 162 (H162R)
Ref Sequence ENSEMBL: ENSMUSP00000141054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068880] [ENSMUST00000167119] [ENSMUST00000187651] [ENSMUST00000189400]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068880
AA Change: H162R

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069127
Gene: ENSMUSG00000025931
AA Change: H162R

DomainStartEndE-ValueType
Pfam:HlyIII 70 297 1.7e-47 PFAM
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167119
AA Change: H162R

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128781
Gene: ENSMUSG00000025931
AA Change: H162R

DomainStartEndE-ValueType
Pfam:HlyIII 70 297 1.2e-53 PFAM
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187651
AA Change: H162R

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140913
Gene: ENSMUSG00000025931
AA Change: H162R

DomainStartEndE-ValueType
Pfam:HlyIII 70 297 1.7e-47 PFAM
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189400
AA Change: H162R

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141054
Gene: ENSMUSG00000025931
AA Change: H162R

DomainStartEndE-ValueType
Pfam:HlyIII 70 297 1.7e-47 PFAM
transmembrane domain 319 341 N/A INTRINSIC
Meta Mutation Damage Score 0.8878 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casc1 A G 6: 145,181,776 V469A probably benign Het
Ckap2l A T 2: 129,285,379 M293K probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Efcab7 G A 4: 99,878,170 R132H probably benign Het
Elovl4 T C 9: 83,780,764 T239A probably benign Het
Fank1 A G 7: 133,879,892 D240G probably damaging Het
Fbln5 T A 12: 101,757,444 M346L possibly damaging Het
Fbxl21 T C 13: 56,532,323 F174L probably benign Het
Gns A G 10: 121,380,185 D279G probably benign Het
Hmcn1 A G 1: 150,679,514 V2502A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Large2 A G 2: 92,374,743 probably benign Het
Lrrc8b A T 5: 105,480,252 I155F probably damaging Het
Morc2b T C 17: 33,138,379 I140V probably benign Het
Mrgprb5 G A 7: 48,168,048 S313L probably benign Het
Nectin4 A T 1: 171,383,705 T266S probably benign Het
Nsd1 C T 13: 55,247,346 A1023V possibly damaging Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Pclo G A 5: 14,676,923 probably benign Het
Phactr4 T C 4: 132,370,982 D325G probably damaging Het
Plcg2 A T 8: 117,634,793 E1255V possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Polr3b A T 10: 84,667,416 Q399L probably benign Het
Ppp1r35 G A 5: 137,780,024 probably benign Het
Psd3 A T 8: 67,713,725 D919E probably benign Het
Ptgs2 A G 1: 150,102,730 T198A possibly damaging Het
Ptpn14 T C 1: 189,832,800 probably null Het
Ptprk A G 10: 28,585,586 Y39C probably damaging Het
R3hdm4 A G 10: 79,913,341 Y75H probably benign Het
Rsph4a A G 10: 33,909,383 Y430C probably damaging Het
Samd12 C T 15: 53,860,273 C8Y probably damaging Het
Sema3e A C 5: 14,226,648 L314F probably damaging Het
Sis A G 3: 72,949,756 F401L probably damaging Het
Smoc1 T A 12: 81,104,700 S64T probably damaging Het
Socs5 T A 17: 87,134,341 H236Q probably damaging Het
Spaca1 C A 4: 34,049,863 R45L possibly damaging Het
Spag6 A G 2: 18,745,513 K457E probably benign Het
Stat2 T A 10: 128,281,065 probably null Het
Tcp11l2 A G 10: 84,613,660 I496M probably damaging Het
Ttll4 A G 1: 74,686,376 I648V possibly damaging Het
Vmn2r67 T C 7: 85,152,245 Y161C probably damaging Het
Wnt5b A T 6: 119,433,852 V171E probably damaging Het
Zfp236 T C 18: 82,630,094 K933E probably damaging Het
Zfp236 T C 18: 82,658,073 E373G probably damaging Het
Zfp617 A G 8: 71,933,041 Y405C probably damaging Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Paqr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01996:Paqr8 APN 1 20935404 missense probably damaging 1.00
IGL02720:Paqr8 APN 1 20935509 nonsense probably null
LCD18:Paqr8 UTSW 1 20914658 intron probably benign
R0190:Paqr8 UTSW 1 20935047 missense probably benign 0.00
R0566:Paqr8 UTSW 1 20935463 missense possibly damaging 0.63
R1491:Paqr8 UTSW 1 20934824 missense probably benign
R1885:Paqr8 UTSW 1 20935480 missense probably damaging 1.00
R3195:Paqr8 UTSW 1 20935033 missense probably damaging 1.00
R3751:Paqr8 UTSW 1 20935632 missense probably benign 0.23
R3752:Paqr8 UTSW 1 20935632 missense probably benign 0.23
R3753:Paqr8 UTSW 1 20935632 missense probably benign 0.23
R4748:Paqr8 UTSW 1 20935413 missense probably benign 0.06
R5207:Paqr8 UTSW 1 20935258 missense probably benign 0.00
R5267:Paqr8 UTSW 1 20934696 missense probably benign
R7389:Paqr8 UTSW 1 20935165 missense probably damaging 1.00
R7468:Paqr8 UTSW 1 20935218 missense probably damaging 1.00
Z1176:Paqr8 UTSW 1 20934798 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCGGTCCTTTTGCGATTC -3'
(R):5'- ATGTCTAGGACGAAGGCCAG -3'

Sequencing Primer
(F):5'- ATTGCAGTGGGCCTCTCC -3'
(R):5'- GCCCTGCTGGTACTACTTGACAG -3'
Posted On2016-07-06