Mutagenetix > Incidental Mutations

Incidental Mutation 'R5264:Nsd1'

401618

Institutional Source

Beutler Lab

Gene Symbol

Nsd1

Ensembl Gene

ENSMUSG00000021488

Gene Name

nuclear receptor-binding SET-domain protein 1

Synonyms

KMT3B

MMRRC Submission

042832-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5264 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55209782-55318325 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 55247346 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1023 (A1023V)

Ref Sequence

ENSEMBL: ENSMUSP00000097089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099490] [ENSMUST00000224973]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099490
AA Change: A1023V

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000097089
Gene: ENSMUSG00000021488
AA Change: A1023V

Domain	Start	End	E-Value	Type
low complexity region	177	187	N/A	INTRINSIC
low complexity region	281	289	N/A	INTRINSIC
PWWP	322	388	1.97e-3	SMART
low complexity region	635	644	N/A	INTRINSIC
low complexity region	980	1000	N/A	INTRINSIC
low complexity region	1296	1309	N/A	INTRINSIC
PHD	1546	1588	4.25e-8	SMART
PHD	1593	1640	3.79e-5	SMART
RING	1594	1639	1.08e-1	SMART
PHD	1641	1694	1.09e1	SMART
PHD	1710	1750	1.02e-10	SMART
PWWP	1755	1817	8.87e-29	SMART
AWS	1891	1942	3.02e-22	SMART
SET	1943	2066	1e-45	SMART
PostSET	2067	2083	3.99e-3	SMART
PHD	2121	2164	1.08e-9	SMART
low complexity region	2224	2237	N/A	INTRINSIC
low complexity region	2276	2286	N/A	INTRINSIC
low complexity region	2335	2356	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224973
AA Change: A920V

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.8%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a SET domain, 2 LXXLL motifs, 3 nuclear translocation signals (NLSs), 4 plant homeodomain (PHD) finger regions, and a proline-rich region. The encoded protein enhances androgen receptor (AR) transactivation, and this enhancement can be increased further in the presence of other androgen receptor associated coregulators. This protein may act as a nucleus-localized, basic transcriptional factor and also as a bifunctional transcriptional regulator. Mutations of this gene have been associated with Sotos syndrome and Weaver syndrome. One version of childhood acute myeloid leukemia is the result of a cryptic translocation with the breakpoints occurring within nuclear receptor-binding Su-var, enhancer of zeste, and trithorax domain protein 1 on chromosome 5 and nucleoporin, 98-kd on chromosome 11. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit excess apoptosis and retarded growth, fail to complete gastrulation, and are resorbed by embryonic day 10. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Casc1	A	G	6: 145,181,776	V469A	probably benign	Het
Ckap2l	A	T	2: 129,285,379	M293K	probably benign	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Efcab7	G	A	4: 99,878,170	R132H	probably benign	Het
Elovl4	T	C	9: 83,780,764	T239A	probably benign	Het
Fank1	A	G	7: 133,879,892	D240G	probably damaging	Het
Fbln5	T	A	12: 101,757,444	M346L	possibly damaging	Het
Fbxl21	T	C	13: 56,532,323	F174L	probably benign	Het
Gns	A	G	10: 121,380,185	D279G	probably benign	Het
Hmcn1	A	G	1: 150,679,514	V2502A	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Large2	A	G	2: 92,374,743		probably benign	Het
Lrrc8b	A	T	5: 105,480,252	I155F	probably damaging	Het
Morc2b	T	C	17: 33,138,379	I140V	probably benign	Het
Mrgprb5	G	A	7: 48,168,048	S313L	probably benign	Het
Nectin4	A	T	1: 171,383,705	T266S	probably benign	Het
Olfr33	T	C	7: 102,714,351	T21A	probably benign	Het
Paqr8	A	G	1: 20,935,108	H162R	possibly damaging	Het
Pclo	G	A	5: 14,676,923		probably benign	Het
Phactr4	T	C	4: 132,370,982	D325G	probably damaging	Het
Plcg2	A	T	8: 117,634,793	E1255V	possibly damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Polr3b	A	T	10: 84,667,416	Q399L	probably benign	Het
Ppp1r35	G	A	5: 137,780,024		probably benign	Het
Psd3	A	T	8: 67,713,725	D919E	probably benign	Het
Ptgs2	A	G	1: 150,102,730	T198A	possibly damaging	Het
Ptpn14	T	C	1: 189,832,800		probably null	Het
Ptprk	A	G	10: 28,585,586	Y39C	probably damaging	Het
R3hdm4	A	G	10: 79,913,341	Y75H	probably benign	Het
Rsph4a	A	G	10: 33,909,383	Y430C	probably damaging	Het
Samd12	C	T	15: 53,860,273	C8Y	probably damaging	Het
Sema3e	A	C	5: 14,226,648	L314F	probably damaging	Het
Sis	A	G	3: 72,949,756	F401L	probably damaging	Het
Smoc1	T	A	12: 81,104,700	S64T	probably damaging	Het
Socs5	T	A	17: 87,134,341	H236Q	probably damaging	Het
Spaca1	C	A	4: 34,049,863	R45L	possibly damaging	Het
Spag6	A	G	2: 18,745,513	K457E	probably benign	Het
Stat2	T	A	10: 128,281,065		probably null	Het
Tcp11l2	A	G	10: 84,613,660	I496M	probably damaging	Het
Ttll4	A	G	1: 74,686,376	I648V	possibly damaging	Het
Vmn2r67	T	C	7: 85,152,245	Y161C	probably damaging	Het
Wnt5b	A	T	6: 119,433,852	V171E	probably damaging	Het
Zfp236	T	C	18: 82,630,094	K933E	probably damaging	Het
Zfp236	T	C	18: 82,658,073	E373G	probably damaging	Het
Zfp617	A	G	8: 71,933,041	Y405C	probably damaging	Het
Zranb1	CTGATGATGATG	CTGATGATGATGATG	7: 132,982,827		probably benign	Het

Other mutations in Nsd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Nsd1	APN	13	55238735	missense	probably damaging	1.00
IGL01060:Nsd1	APN	13	55263429	missense	probably damaging	1.00
IGL01125:Nsd1	APN	13	55245617	missense	probably damaging	1.00
IGL01746:Nsd1	APN	13	55276515	splice site	probably null
IGL02437:Nsd1	APN	13	55313441	missense	probably damaging	1.00
IGL02530:Nsd1	APN	13	55302833	splice site	probably benign
IGL02557:Nsd1	APN	13	55312448	missense	probably damaging	1.00
IGL02572:Nsd1	APN	13	55296130	missense	probably damaging	1.00
IGL02665:Nsd1	APN	13	55296183	missense	probably damaging	1.00
IGL02870:Nsd1	APN	13	55313603	missense	probably benign	0.06
IGL03181:Nsd1	APN	13	55247045	missense	probably damaging	1.00
Amanuensis	UTSW	13	55261626	nonsense	probably null
scribe	UTSW	13	55291236	missense	probably damaging	1.00
PIT4480001:Nsd1	UTSW	13	55213918	missense	probably benign	0.11
R0316:Nsd1	UTSW	13	55213771	missense	probably damaging	0.98
R0519:Nsd1	UTSW	13	55312835	missense	probably benign	0.04
R0542:Nsd1	UTSW	13	55260458	missense	possibly damaging	0.93
R0563:Nsd1	UTSW	13	55246578	missense	possibly damaging	0.48
R0652:Nsd1	UTSW	13	55247586	missense	possibly damaging	0.92
R0906:Nsd1	UTSW	13	55277590	missense	probably benign	0.30
R1560:Nsd1	UTSW	13	55246720	nonsense	probably null
R1572:Nsd1	UTSW	13	55246969	missense	probably damaging	0.98
R1693:Nsd1	UTSW	13	55247261	missense	probably benign
R1697:Nsd1	UTSW	13	55214059	critical splice acceptor site	probably null
R1720:Nsd1	UTSW	13	55246898	missense	probably damaging	0.98
R1829:Nsd1	UTSW	13	55246369	missense	probably damaging	1.00
R1834:Nsd1	UTSW	13	55313351	missense	possibly damaging	0.52
R1842:Nsd1	UTSW	13	55246445	missense	probably damaging	1.00
R1880:Nsd1	UTSW	13	55213793	missense	probably damaging	0.99
R2022:Nsd1	UTSW	13	55213279	missense	probably damaging	0.99
R2075:Nsd1	UTSW	13	55310500	missense	possibly damaging	0.74
R2143:Nsd1	UTSW	13	55260397	missense	probably damaging	1.00
R2151:Nsd1	UTSW	13	55291236	missense	probably damaging	1.00
R2316:Nsd1	UTSW	13	55233966	missense	probably damaging	1.00
R2359:Nsd1	UTSW	13	55213711	missense	possibly damaging	0.90
R2361:Nsd1	UTSW	13	55213711	missense	possibly damaging	0.90
R2656:Nsd1	UTSW	13	55246868	missense	probably damaging	1.00
R2849:Nsd1	UTSW	13	55213692	missense	probably damaging	0.99
R3237:Nsd1	UTSW	13	55312888	missense	possibly damaging	0.92
R3772:Nsd1	UTSW	13	55246673	missense	probably benign	0.00
R3773:Nsd1	UTSW	13	55246673	missense	probably benign	0.00
R3849:Nsd1	UTSW	13	55246691	missense	probably benign	0.00
R3951:Nsd1	UTSW	13	55268454	missense	probably benign	0.05
R4036:Nsd1	UTSW	13	55213711	missense	possibly damaging	0.90
R4073:Nsd1	UTSW	13	55247728	missense	probably benign	0.28
R4080:Nsd1	UTSW	13	55301809	missense	probably damaging	0.96
R4226:Nsd1	UTSW	13	55260401	missense	probably damaging	1.00
R4485:Nsd1	UTSW	13	55245621	missense	probably benign
R4703:Nsd1	UTSW	13	55214063	missense	probably damaging	1.00
R4853:Nsd1	UTSW	13	55268504	missense	probably benign	0.30
R4915:Nsd1	UTSW	13	55247868	missense	possibly damaging	0.65
R4915:Nsd1	UTSW	13	55276528	missense	probably benign	0.00
R5348:Nsd1	UTSW	13	55312334	missense	probably benign	0.00
R5473:Nsd1	UTSW	13	55247772	missense	probably damaging	1.00
R5498:Nsd1	UTSW	13	55213302	nonsense	probably null
R5503:Nsd1	UTSW	13	55245939	missense	probably damaging	1.00
R5511:Nsd1	UTSW	13	55312730	missense	probably benign	0.00
R5683:Nsd1	UTSW	13	55246148	missense	probably benign	0.00
R5778:Nsd1	UTSW	13	55306979	missense	probably damaging	1.00
R5793:Nsd1	UTSW	13	55248006	missense	probably benign
R5922:Nsd1	UTSW	13	55247475	missense	probably benign	0.01
R5956:Nsd1	UTSW	13	55263404	missense	probably damaging	1.00
R6053:Nsd1	UTSW	13	55293609	missense	probably damaging	1.00
R6141:Nsd1	UTSW	13	55291284	missense	probably damaging	1.00
R6158:Nsd1	UTSW	13	55245621	missense	probably benign
R6224:Nsd1	UTSW	13	55313132	missense	possibly damaging	0.85
R6396:Nsd1	UTSW	13	55238789	missense	probably damaging	1.00
R6598:Nsd1	UTSW	13	55293702	missense	possibly damaging	0.94
R7170:Nsd1	UTSW	13	55261626	nonsense	probably null
R7205:Nsd1	UTSW	13	55246470	missense	probably damaging	1.00
R7215:Nsd1	UTSW	13	55247641	missense	probably benign	0.00
R7337:Nsd1	UTSW	13	55246209	missense	probably damaging	1.00
R7432:Nsd1	UTSW	13	55213374	missense	probably benign
R7638:Nsd1	UTSW	13	55312328	missense	probably benign	0.01
R7647:Nsd1	UTSW	13	55299835	missense	probably damaging	0.96
R7658:Nsd1	UTSW	13	55277639	missense	probably damaging	1.00
Z1088:Nsd1	UTSW	13	55213848	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- AAAAGCCTGGAGATAGCACTC -3'
(R):5'- AGGTCCATTTGTTGCAGAGG -3'

Sequencing Primer
(F):5'- GAGATAGCACTCAGGACTCAGTTC -3'
(R):5'- GCAGAGGCTCTTCTTTACCAGG -3'

Posted On

2016-07-06