Mutagenetix > Incidental Mutations

Incidental Mutation 'R5264:Ptpn14'

401582

Institutional Source

Beutler Lab

Gene Symbol

Ptpn14

Ensembl Gene

ENSMUSG00000026604

Gene Name

protein tyrosine phosphatase, non-receptor type 14

Synonyms

C130080N23Rik, PTP36, OTTMUSG00000022087

MMRRC Submission

042832-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5264 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

189728268-189876695 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 189832800 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000095051 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027898] [ENSMUST00000027898] [ENSMUST00000097442] [ENSMUST00000097442]

Predicted Effect

probably null
Transcript: ENSMUST00000027898

SMART Domains

Protein: ENSMUSP00000027898
Gene: ENSMUSG00000026604

Domain	Start	End	E-Value	Type
B41	17	220	3.7e-67	SMART
FERM_C	224	310	3.43e-15	SMART
low complexity region	565	575	N/A	INTRINSIC
low complexity region	633	639	N/A	INTRINSIC
low complexity region	710	718	N/A	INTRINSIC
low complexity region	745	758	N/A	INTRINSIC
low complexity region	817	834	N/A	INTRINSIC
PTPc	910	1184	2.14e-103	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000027898

SMART Domains

Protein: ENSMUSP00000027898
Gene: ENSMUSG00000026604

Domain	Start	End	E-Value	Type
B41	17	220	3.7e-67	SMART
FERM_C	224	310	3.43e-15	SMART
low complexity region	565	575	N/A	INTRINSIC
low complexity region	633	639	N/A	INTRINSIC
low complexity region	710	718	N/A	INTRINSIC
low complexity region	745	758	N/A	INTRINSIC
low complexity region	817	834	N/A	INTRINSIC
PTPc	910	1184	2.14e-103	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000097442

SMART Domains

Protein: ENSMUSP00000095051
Gene: ENSMUSG00000026604

Domain	Start	End	E-Value	Type
B41	17	220	3.7e-67	SMART
FERM_C	224	310	3.43e-15	SMART
low complexity region	565	575	N/A	INTRINSIC
low complexity region	633	639	N/A	INTRINSIC
low complexity region	710	718	N/A	INTRINSIC
low complexity region	745	758	N/A	INTRINSIC
low complexity region	817	834	N/A	INTRINSIC
PTPc	910	1184	2.14e-103	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000097442

SMART Domains

Protein: ENSMUSP00000095051
Gene: ENSMUSG00000026604

Domain	Start	End	E-Value	Type
B41	17	220	3.7e-67	SMART
FERM_C	224	310	3.43e-15	SMART
low complexity region	565	575	N/A	INTRINSIC
low complexity region	633	639	N/A	INTRINSIC
low complexity region	710	718	N/A	INTRINSIC
low complexity region	745	758	N/A	INTRINSIC
low complexity region	817	834	N/A	INTRINSIC
PTPc	910	1184	2.14e-103	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128275

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181876

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194127

Meta Mutation Damage Score

0.9489

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.8%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal noncatalytic domain similar to that of band 4.1 superfamily cytoskeleton-associated proteins, which suggested the membrane or cytoskeleton localization of this protein. It appears to regulate lymphatic development in mammals, and a loss of function mutation has been found in a kindred with a lymphedema-choanal atresia. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit some postnatal growth retardation, decreased body weight, periorbital and limb edema, and lymphatic vessel hyperplasia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Casc1	A	G	6: 145,181,776	V469A	probably benign	Het
Ckap2l	A	T	2: 129,285,379	M293K	probably benign	Het
Col4a4	C	T	1: 82,493,591	G681E	unknown	Het
Efcab7	G	A	4: 99,878,170	R132H	probably benign	Het
Elovl4	T	C	9: 83,780,764	T239A	probably benign	Het
Fank1	A	G	7: 133,879,892	D240G	probably damaging	Het
Fbln5	T	A	12: 101,757,444	M346L	possibly damaging	Het
Fbxl21	T	C	13: 56,532,323	F174L	probably benign	Het
Gns	A	G	10: 121,380,185	D279G	probably benign	Het
Hmcn1	A	G	1: 150,679,514	V2502A	probably benign	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Large2	A	G	2: 92,374,743		probably benign	Het
Lrrc8b	A	T	5: 105,480,252	I155F	probably damaging	Het
Morc2b	T	C	17: 33,138,379	I140V	probably benign	Het
Mrgprb5	G	A	7: 48,168,048	S313L	probably benign	Het
Nectin4	A	T	1: 171,383,705	T266S	probably benign	Het
Nsd1	C	T	13: 55,247,346	A1023V	possibly damaging	Het
Olfr33	T	C	7: 102,714,351	T21A	probably benign	Het
Paqr8	A	G	1: 20,935,108	H162R	possibly damaging	Het
Pclo	G	A	5: 14,676,923		probably benign	Het
Phactr4	T	C	4: 132,370,982	D325G	probably damaging	Het
Plcg2	A	T	8: 117,634,793	E1255V	possibly damaging	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Polr3b	A	T	10: 84,667,416	Q399L	probably benign	Het
Ppp1r35	G	A	5: 137,780,024		probably benign	Het
Psd3	A	T	8: 67,713,725	D919E	probably benign	Het
Ptgs2	A	G	1: 150,102,730	T198A	possibly damaging	Het
Ptprk	A	G	10: 28,585,586	Y39C	probably damaging	Het
R3hdm4	A	G	10: 79,913,341	Y75H	probably benign	Het
Rsph4a	A	G	10: 33,909,383	Y430C	probably damaging	Het
Samd12	C	T	15: 53,860,273	C8Y	probably damaging	Het
Sema3e	A	C	5: 14,226,648	L314F	probably damaging	Het
Sis	A	G	3: 72,949,756	F401L	probably damaging	Het
Smoc1	T	A	12: 81,104,700	S64T	probably damaging	Het
Socs5	T	A	17: 87,134,341	H236Q	probably damaging	Het
Spaca1	C	A	4: 34,049,863	R45L	possibly damaging	Het
Spag6	A	G	2: 18,745,513	K457E	probably benign	Het
Stat2	T	A	10: 128,281,065		probably null	Het
Tcp11l2	A	G	10: 84,613,660	I496M	probably damaging	Het
Ttll4	A	G	1: 74,686,376	I648V	possibly damaging	Het
Vmn2r67	T	C	7: 85,152,245	Y161C	probably damaging	Het
Wnt5b	A	T	6: 119,433,852	V171E	probably damaging	Het
Zfp236	T	C	18: 82,630,094	K933E	probably damaging	Het
Zfp236	T	C	18: 82,658,073	E373G	probably damaging	Het
Zfp617	A	G	8: 71,933,041	Y405C	probably damaging	Het
Zranb1	CTGATGATGATG	CTGATGATGATGATG	7: 132,982,827		probably benign	Het

Other mutations in Ptpn14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Ptpn14	APN	1	189822633	missense	probably damaging	1.00
IGL02501:Ptpn14	APN	1	189850390	missense	probably benign	0.14
IGL03011:Ptpn14	APN	1	189839557	missense	probably damaging	1.00
R0724:Ptpn14	UTSW	1	189850947	missense	possibly damaging	0.52
R0791:Ptpn14	UTSW	1	189836440	splice site	probably benign
R1363:Ptpn14	UTSW	1	189798628	missense	probably damaging	1.00
R1605:Ptpn14	UTSW	1	189865512	missense	probably benign	0.00
R1840:Ptpn14	UTSW	1	189786851	missense	probably damaging	1.00
R1845:Ptpn14	UTSW	1	189839502	missense	possibly damaging	0.96
R1891:Ptpn14	UTSW	1	189798653	missense	probably damaging	1.00
R2187:Ptpn14	UTSW	1	189863228	nonsense	probably null
R2288:Ptpn14	UTSW	1	189865498	missense	probably damaging	1.00
R3686:Ptpn14	UTSW	1	189851399	missense	probably damaging	1.00
R3895:Ptpn14	UTSW	1	189850546	missense	probably benign	0.31
R3898:Ptpn14	UTSW	1	189850531	missense	probably benign	0.35
R4004:Ptpn14	UTSW	1	189850510	missense	probably benign	0.00
R4816:Ptpn14	UTSW	1	189856800	missense	probably damaging	1.00
R4883:Ptpn14	UTSW	1	189850800	missense	probably damaging	0.99
R4928:Ptpn14	UTSW	1	189822642	missense	probably damaging	1.00
R4931:Ptpn14	UTSW	1	189851277	missense	probably benign
R4957:Ptpn14	UTSW	1	189851272	missense	probably benign	0.02
R5009:Ptpn14	UTSW	1	189850534	missense	probably benign
R5038:Ptpn14	UTSW	1	189786886	missense	probably damaging	1.00
R5373:Ptpn14	UTSW	1	189850963	missense	probably benign
R5441:Ptpn14	UTSW	1	189798570	missense	probably damaging	1.00
R5540:Ptpn14	UTSW	1	189846364	missense	probably benign	0.05
R5638:Ptpn14	UTSW	1	189786841	missense	probably damaging	1.00
R5746:Ptpn14	UTSW	1	189846413	critical splice donor site	probably null
R5872:Ptpn14	UTSW	1	189851032	missense	probably benign	0.00
R5988:Ptpn14	UTSW	1	189850387	missense	probably damaging	1.00
R6139:Ptpn14	UTSW	1	189851165	missense	probably benign	0.01
R6295:Ptpn14	UTSW	1	189850800	missense	probably damaging	0.99
R6770:Ptpn14	UTSW	1	189832773	missense	probably damaging	1.00
R7097:Ptpn14	UTSW	1	189863398	nonsense	probably null
R7320:Ptpn14	UTSW	1	189832759	missense	probably benign	0.11
R7324:Ptpn14	UTSW	1	189863424	missense	possibly damaging	0.46
R7599:Ptpn14	UTSW	1	189850745	missense	probably benign	0.39
R7699:Ptpn14	UTSW	1	189865411	missense	probably benign	0.08
R7700:Ptpn14	UTSW	1	189865411	missense	probably benign	0.08
R8379:Ptpn14	UTSW	1	189833401	missense	possibly damaging	0.95
Z1177:Ptpn14	UTSW	1	189860470	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TAGGGACCATATACCTGAGCCTAG -3'
(R):5'- AGATACCAGTTTGCTCAGGAC -3'

Sequencing Primer
(F):5'- ATATACCTGAGCCTAGTCTTCTGGG -3'
(R):5'- CCAGTTTGCTCAGGACTATGAAG -3'

Posted On

2016-07-06