Incidental Mutation 'R5264:Efcab7'
ID401590
Institutional Source Beutler Lab
Gene Symbol Efcab7
Ensembl Gene ENSMUSG00000073791
Gene NameEF-hand calcium binding domain 7
Synonyms
MMRRC Submission 042832-MU
Accession Numbers

Genbank: NM_145549; MGI: 2385199

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5264 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location99829198-99912788 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99878170 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 132 (R132H)
Ref Sequence ENSEMBL: ENSMUSP00000095572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097959]
Predicted Effect probably benign
Transcript: ENSMUST00000097959
AA Change: R132H

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095572
Gene: ENSMUSG00000073791
AA Change: R132H

DomainStartEndE-ValueType
low complexity region 85 99 N/A INTRINSIC
SCOP:d2pvba_ 339 408 2e-4 SMART
Blast:EFh 348 376 2e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123830
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (54/55)
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Casc1 A G 6: 145,181,776 V469A probably benign Het
Ckap2l A T 2: 129,285,379 M293K probably benign Het
Col4a4 C T 1: 82,493,591 G681E unknown Het
Elovl4 T C 9: 83,780,764 T239A probably benign Het
Fank1 A G 7: 133,879,892 D240G probably damaging Het
Fbln5 T A 12: 101,757,444 M346L possibly damaging Het
Fbxl21 T C 13: 56,532,323 F174L probably benign Het
Gns A G 10: 121,380,185 D279G probably benign Het
Hmcn1 A G 1: 150,679,514 V2502A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Large2 A G 2: 92,374,743 probably benign Het
Lrrc8b A T 5: 105,480,252 I155F probably damaging Het
Morc2b T C 17: 33,138,379 I140V probably benign Het
Mrgprb5 G A 7: 48,168,048 S313L probably benign Het
Nectin4 A T 1: 171,383,705 T266S probably benign Het
Nsd1 C T 13: 55,247,346 A1023V possibly damaging Het
Olfr33 T C 7: 102,714,351 T21A probably benign Het
Paqr8 A G 1: 20,935,108 H162R possibly damaging Het
Pclo G A 5: 14,676,923 probably benign Het
Phactr4 T C 4: 132,370,982 D325G probably damaging Het
Plcg2 A T 8: 117,634,793 E1255V possibly damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Polr3b A T 10: 84,667,416 Q399L probably benign Het
Ppp1r35 G A 5: 137,780,024 probably benign Het
Psd3 A T 8: 67,713,725 D919E probably benign Het
Ptgs2 A G 1: 150,102,730 T198A possibly damaging Het
Ptpn14 T C 1: 189,832,800 probably null Het
Ptprk A G 10: 28,585,586 Y39C probably damaging Het
R3hdm4 A G 10: 79,913,341 Y75H probably benign Het
Rsph4a A G 10: 33,909,383 Y430C probably damaging Het
Samd12 C T 15: 53,860,273 C8Y probably damaging Het
Sema3e A C 5: 14,226,648 L314F probably damaging Het
Sis A G 3: 72,949,756 F401L probably damaging Het
Smoc1 T A 12: 81,104,700 S64T probably damaging Het
Socs5 T A 17: 87,134,341 H236Q probably damaging Het
Spaca1 C A 4: 34,049,863 R45L possibly damaging Het
Spag6 A G 2: 18,745,513 K457E probably benign Het
Stat2 T A 10: 128,281,065 probably null Het
Tcp11l2 A G 10: 84,613,660 I496M probably damaging Het
Ttll4 A G 1: 74,686,376 I648V possibly damaging Het
Vmn2r67 T C 7: 85,152,245 Y161C probably damaging Het
Wnt5b A T 6: 119,433,852 V171E probably damaging Het
Zfp236 T C 18: 82,630,094 K933E probably damaging Het
Zfp236 T C 18: 82,658,073 E373G probably damaging Het
Zfp617 A G 8: 71,933,041 Y405C probably damaging Het
Zranb1 CTGATGATGATG CTGATGATGATGATG 7: 132,982,827 probably benign Het
Other mutations in Efcab7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Efcab7 APN 4 99831463 missense probably benign 0.12
3-1:Efcab7 UTSW 4 99901769 missense possibly damaging 0.83
R0023:Efcab7 UTSW 4 99901637 splice site probably benign
R0085:Efcab7 UTSW 4 99904680 unclassified probably benign
R0122:Efcab7 UTSW 4 99892363 splice site probably benign
R0326:Efcab7 UTSW 4 99831394 missense possibly damaging 0.86
R0382:Efcab7 UTSW 4 99901769 missense possibly damaging 0.83
R0410:Efcab7 UTSW 4 99878285 critical splice donor site probably null
R0413:Efcab7 UTSW 4 99909746 missense probably damaging 1.00
R0611:Efcab7 UTSW 4 99901689 missense probably damaging 1.00
R0689:Efcab7 UTSW 4 99904784 missense probably damaging 1.00
R1114:Efcab7 UTSW 4 99878250 nonsense probably null
R1459:Efcab7 UTSW 4 99912547 missense probably null 1.00
R1722:Efcab7 UTSW 4 99900618 missense probably benign 0.36
R1932:Efcab7 UTSW 4 99911018 missense probably damaging 1.00
R1954:Efcab7 UTSW 4 99900690 missense probably damaging 1.00
R2305:Efcab7 UTSW 4 99831481 missense possibly damaging 0.95
R2358:Efcab7 UTSW 4 99831586 unclassified probably benign
R2845:Efcab7 UTSW 4 99909638 missense probably damaging 0.99
R3915:Efcab7 UTSW 4 99878173 missense probably damaging 0.98
R4469:Efcab7 UTSW 4 99909704 missense possibly damaging 0.73
R4686:Efcab7 UTSW 4 99878116 missense probably benign 0.29
R4737:Efcab7 UTSW 4 99831568 nonsense probably null
R4970:Efcab7 UTSW 4 99831543 missense probably damaging 1.00
R5120:Efcab7 UTSW 4 99897491 missense probably damaging 1.00
R5366:Efcab7 UTSW 4 99904734 missense possibly damaging 0.95
R5901:Efcab7 UTSW 4 99909744 missense probably damaging 0.99
R6255:Efcab7 UTSW 4 99829390 unclassified probably benign
R6438:Efcab7 UTSW 4 99909772 missense probably benign 0.39
R6451:Efcab7 UTSW 4 99831501 nonsense probably null
R6717:Efcab7 UTSW 4 99904734 missense possibly damaging 0.95
R6766:Efcab7 UTSW 4 99877959 frame shift probably null
R6855:Efcab7 UTSW 4 99900580 nonsense probably null
R6865:Efcab7 UTSW 4 99912596 missense probably damaging 1.00
R7868:Efcab7 UTSW 4 99888957 missense probably benign 0.01
R7893:Efcab7 UTSW 4 99888861 missense probably damaging 1.00
R8069:Efcab7 UTSW 4 99829378 missense unknown
Predicted Primers PCR Primer
(F):5'- GAAATGTGTTTCAGCACGAGCC -3'
(R):5'- TGTTGATAACCTGAGATGAAAGGAC -3'

Sequencing Primer
(F):5'- AGCACGAGCCTCCTCCTTG -3'
(R):5'- ACCTGAGATGAAAGGACAATTTTG -3'
Posted On2016-07-06