Incidental Mutation 'R5189:Nkx2-3'
ID405079
Institutional Source Beutler Lab
Gene Symbol Nkx2-3
Ensembl Gene ENSMUSG00000044220
Gene NameNK2 homeobox 3
Synonymstinman, Nkx2.3, Nkx-2.3
MMRRC Submission 042767-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.647) question?
Stock #R5189 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location43612325-43615892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 43612708 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 70 (S70A)
Ref Sequence ENSEMBL: ENSMUSP00000050933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057178]
Predicted Effect probably benign
Transcript: ENSMUST00000057178
AA Change: S70A

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000050933
Gene: ENSMUSG00000044220
AA Change: S70A

DomainStartEndE-ValueType
low complexity region 58 67 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
HOX 145 207 2.39e-24 SMART
low complexity region 215 227 N/A INTRINSIC
low complexity region 294 310 N/A INTRINSIC
low complexity region 330 337 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172872
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeodomain-containing transcription factor. The encoded protein is a member of the NKX family of homeodomain transcription factors. Studies of similar proteins in mouse and rat have indicated a potential role in cellular differentiation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes exhibit postnatal lethality due to acute intestinal malabsorption. Survivors recover well but exhibit splenic and Peyer's patch hypoplasia, intestinal villus malformation, gut truncation and distension, abnormal molar and sublingual gland development, and deranged lymphocyte homing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik C T 12: 71,193,349 T1311I possibly damaging Het
4930505A04Rik T C 11: 30,426,169 T233A probably damaging Het
Ankar T C 1: 72,658,414 I859V probably benign Het
Cacnb2 G T 2: 14,986,038 A644S possibly damaging Het
Gatb T C 3: 85,636,931 V402A probably benign Het
Gpcpd1 T C 2: 132,553,972 K153R probably damaging Het
Hip1 A G 5: 135,434,293 L60S probably damaging Het
Hsf4 GCAGCACCGGGTCA G 8: 105,271,428 probably null Het
Hydin A T 8: 110,413,211 probably null Het
Igsf3 A T 3: 101,431,527 T386S possibly damaging Het
Il12rb1 A G 8: 70,811,058 T88A possibly damaging Het
Kank1 T C 19: 25,424,181 S1051P probably damaging Het
Kap A G 6: 133,851,916 probably null Het
Ly96 A G 1: 16,700,867 E74G probably damaging Het
Map7d1 G T 4: 126,242,304 probably null Het
Megf6 G T 4: 154,252,523 R253L probably benign Het
Mex3b A G 7: 82,869,251 D258G probably damaging Het
Mpzl3 T C 9: 45,062,110 I49T possibly damaging Het
Myh15 C A 16: 49,101,507 T472N probably benign Het
Nacad A G 11: 6,601,611 S527P probably damaging Het
Nkx2-6 A T 14: 69,171,893 Q31L probably benign Het
Olfr522 A G 7: 140,162,719 V77A probably damaging Het
Pcdha6 A T 18: 36,968,791 N346Y probably damaging Het
Pkd2 G A 5: 104,459,919 D95N probably benign Het
Pkhd1l1 A G 15: 44,547,148 T2684A probably damaging Het
Plin2 A G 4: 86,657,146 Y389H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc41a2 T C 10: 83,313,411 probably null Het
Smg6 A G 11: 75,041,996 T1038A probably damaging Het
Suds3 T C 5: 117,100,599 probably benign Het
Tbc1d8 T C 1: 39,385,132 H626R probably benign Het
Tmem260 T A 14: 48,509,116 H616Q probably benign Het
Trip10 A T 17: 57,261,288 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Vmn1r84 A T 7: 12,362,458 S103T probably benign Het
Vps13a G T 19: 16,685,315 P1602Q probably damaging Het
Other mutations in Nkx2-3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Nkx2-3 APN 19 43612655 missense possibly damaging 0.59
R1647:Nkx2-3 UTSW 19 43614456 missense probably damaging 1.00
R4704:Nkx2-3 UTSW 19 43612684 missense probably damaging 0.96
R4718:Nkx2-3 UTSW 19 43612643 missense probably benign 0.08
R5490:Nkx2-3 UTSW 19 43612654 missense probably benign 0.00
R5770:Nkx2-3 UTSW 19 43614533 missense probably damaging 1.00
R7124:Nkx2-3 UTSW 19 43614806 missense possibly damaging 0.84
R7457:Nkx2-3 UTSW 19 43612547 missense probably damaging 1.00
R7843:Nkx2-3 UTSW 19 43614882 missense probably benign 0.02
R7926:Nkx2-3 UTSW 19 43614882 missense probably benign 0.02
X0061:Nkx2-3 UTSW 19 43614362 missense probably benign 0.08
Z1177:Nkx2-3 UTSW 19 43614737 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATGTTACCAAGCCCGGTCAC -3'
(R):5'- ACCCTAGCCGAATGTGAAAGG -3'

Sequencing Primer
(F):5'- CCACCCCTTTCTCAGTCAAAG -3'
(R):5'- CCATGCAGGCACGGTTTG -3'
Posted On2016-07-22