Incidental Mutation 'R5189:Map7d1'
ID405050
Institutional Source Beutler Lab
Gene Symbol Map7d1
Ensembl Gene ENSMUSG00000028849
Gene NameMAP7 domain containing 1
SynonymsMtap7d1, Parcc1, Rprc1
MMRRC Submission 042767-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.788) question?
Stock #R5189 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126232167-126256343 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 126242304 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000061143] [ENSMUST00000106132] [ENSMUST00000122129]
Predicted Effect probably damaging
Transcript: ENSMUST00000061143
AA Change: P37Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054338
Gene: ENSMUSG00000028849
AA Change: P37Q

DomainStartEndE-ValueType
low complexity region 25 47 N/A INTRINSIC
low complexity region 110 123 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
low complexity region 323 343 N/A INTRINSIC
coiled coil region 414 444 N/A INTRINSIC
low complexity region 460 471 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
low complexity region 533 558 N/A INTRINSIC
Pfam:MAP7 587 735 7.1e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106132
AA Change: P37Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101738
Gene: ENSMUSG00000028849
AA Change: P37Q

DomainStartEndE-ValueType
low complexity region 25 47 N/A INTRINSIC
low complexity region 110 123 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
coiled coil region 342 372 N/A INTRINSIC
low complexity region 388 399 N/A INTRINSIC
low complexity region 408 425 N/A INTRINSIC
low complexity region 461 486 N/A INTRINSIC
Pfam:MAP7 510 668 1.4e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122129
AA Change: P37Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113250
Gene: ENSMUSG00000028849
AA Change: P37Q

DomainStartEndE-ValueType
low complexity region 25 47 N/A INTRINSIC
low complexity region 110 123 N/A INTRINSIC
coiled coil region 163 224 N/A INTRINSIC
coiled coil region 382 412 N/A INTRINSIC
low complexity region 428 439 N/A INTRINSIC
low complexity region 448 465 N/A INTRINSIC
low complexity region 501 526 N/A INTRINSIC
Pfam:MAP7 550 708 1.5e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000125981
SMART Domains Protein: ENSMUSP00000120292
Gene: ENSMUSG00000028849

DomainStartEndE-ValueType
low complexity region 68 88 N/A INTRINSIC
coiled coil region 158 188 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 225 242 N/A INTRINSIC
low complexity region 278 303 N/A INTRINSIC
Pfam:MAP7 332 480 1.5e-41 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik C T 12: 71,193,349 T1311I possibly damaging Het
4930505A04Rik T C 11: 30,426,169 T233A probably damaging Het
Ankar T C 1: 72,658,414 I859V probably benign Het
Cacnb2 G T 2: 14,986,038 A644S possibly damaging Het
Gatb T C 3: 85,636,931 V402A probably benign Het
Gpcpd1 T C 2: 132,553,972 K153R probably damaging Het
Hip1 A G 5: 135,434,293 L60S probably damaging Het
Hsf4 GCAGCACCGGGTCA G 8: 105,271,428 probably null Het
Hydin A T 8: 110,413,211 probably null Het
Igsf3 A T 3: 101,431,527 T386S possibly damaging Het
Il12rb1 A G 8: 70,811,058 T88A possibly damaging Het
Kank1 T C 19: 25,424,181 S1051P probably damaging Het
Kap A G 6: 133,851,916 probably null Het
Ly96 A G 1: 16,700,867 E74G probably damaging Het
Megf6 G T 4: 154,252,523 R253L probably benign Het
Mex3b A G 7: 82,869,251 D258G probably damaging Het
Mpzl3 T C 9: 45,062,110 I49T possibly damaging Het
Myh15 C A 16: 49,101,507 T472N probably benign Het
Nacad A G 11: 6,601,611 S527P probably damaging Het
Nkx2-3 T G 19: 43,612,708 S70A probably benign Het
Nkx2-6 A T 14: 69,171,893 Q31L probably benign Het
Olfr522 A G 7: 140,162,719 V77A probably damaging Het
Pcdha6 A T 18: 36,968,791 N346Y probably damaging Het
Pkd2 G A 5: 104,459,919 D95N probably benign Het
Pkhd1l1 A G 15: 44,547,148 T2684A probably damaging Het
Plin2 A G 4: 86,657,146 Y389H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc41a2 T C 10: 83,313,411 probably null Het
Smg6 A G 11: 75,041,996 T1038A probably damaging Het
Suds3 T C 5: 117,100,599 probably benign Het
Tbc1d8 T C 1: 39,385,132 H626R probably benign Het
Tmem260 T A 14: 48,509,116 H616Q probably benign Het
Trip10 A T 17: 57,261,288 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Vmn1r84 A T 7: 12,362,458 S103T probably benign Het
Vps13a G T 19: 16,685,315 P1602Q probably damaging Het
Other mutations in Map7d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Map7d1 APN 4 126238605 missense probably damaging 1.00
IGL02298:Map7d1 APN 4 126233921 missense unknown
R0136:Map7d1 UTSW 4 126236631 critical splice donor site probably null
R0362:Map7d1 UTSW 4 126234994 missense probably damaging 1.00
R1138:Map7d1 UTSW 4 126242119 missense possibly damaging 0.82
R1499:Map7d1 UTSW 4 126234765 critical splice donor site probably null
R1692:Map7d1 UTSW 4 126242308 missense probably damaging 0.99
R3805:Map7d1 UTSW 4 126237291 splice site probably null
R4369:Map7d1 UTSW 4 126235073 missense probably damaging 0.99
R4814:Map7d1 UTSW 4 126234321 critical splice donor site probably null
R4893:Map7d1 UTSW 4 126233222 missense unknown
R4898:Map7d1 UTSW 4 126233225 missense unknown
R4911:Map7d1 UTSW 4 126236691 missense probably damaging 1.00
R4949:Map7d1 UTSW 4 126235053 nonsense probably null
R6198:Map7d1 UTSW 4 126241843 missense probably damaging 1.00
R6336:Map7d1 UTSW 4 126236682 missense probably damaging 1.00
R6558:Map7d1 UTSW 4 126232909 missense unknown
R6781:Map7d1 UTSW 4 126240751 frame shift probably null
R7177:Map7d1 UTSW 4 126236985 missense probably damaging 1.00
R7204:Map7d1 UTSW 4 126256015 critical splice donor site probably null
R7269:Map7d1 UTSW 4 126232873 missense unknown
R7486:Map7d1 UTSW 4 126234386 missense unknown
R7560:Map7d1 UTSW 4 126236636 missense probably damaging 1.00
Z1177:Map7d1 UTSW 4 126234377 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCTCTTGGCTTCTGAGGAC -3'
(R):5'- CATGTCAGCTGAGCTATGCTGTATG -3'

Sequencing Primer
(F):5'- TCTGAGGACGGGCATTCTTCC -3'
(R):5'- TATATGAGGCCTGGCACATG -3'
Posted On2016-07-22