Incidental Mutation 'R5189:Tmem260'
ID405071
Institutional Source Beutler Lab
Gene Symbol Tmem260
Ensembl Gene ENSMUSG00000036339
Gene Nametransmembrane protein 260
Synonyms6720456H20Rik
MMRRC Submission 042767-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5189 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location48446124-48524246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48509116 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 616 (H616Q)
Ref Sequence ENSEMBL: ENSMUSP00000154360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111735] [ENSMUST00000124720] [ENSMUST00000153765] [ENSMUST00000226422] [ENSMUST00000227440]
Predicted Effect probably benign
Transcript: ENSMUST00000111735
AA Change: H616Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000107364
Gene: ENSMUSG00000036339
AA Change: H616Q

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:DUF2723 48 211 1.9e-43 PFAM
transmembrane domain 316 338 N/A INTRINSIC
transmembrane domain 353 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124720
AA Change: H464Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000118376
Gene: ENSMUSG00000036339
AA Change: H464Q

DomainStartEndE-ValueType
Pfam:DUF2723 1 61 4.6e-9 PFAM
transmembrane domain 65 87 N/A INTRINSIC
transmembrane domain 164 186 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153765
SMART Domains Protein: ENSMUSP00000116155
Gene: ENSMUSG00000036339

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:DUF2723 48 111 8.3e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226344
Predicted Effect probably benign
Transcript: ENSMUST00000226422
AA Change: H616Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000227440
AA Change: H616Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik C T 12: 71,193,349 T1311I possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
4930505A04Rik T C 11: 30,426,169 T233A probably damaging Het
Ankar T C 1: 72,658,414 I859V probably benign Het
Cacnb2 G T 2: 14,986,038 A644S possibly damaging Het
Gatb T C 3: 85,636,931 V402A probably benign Het
Gpcpd1 T C 2: 132,553,972 K153R probably damaging Het
Hip1 A G 5: 135,434,293 L60S probably damaging Het
Hsf4 GCAGCACCGGGTCA G 8: 105,271,428 probably null Het
Hydin A T 8: 110,413,211 probably null Het
Igsf3 A T 3: 101,431,527 T386S possibly damaging Het
Il12rb1 A G 8: 70,811,058 T88A possibly damaging Het
Kank1 T C 19: 25,424,181 S1051P probably damaging Het
Kap A G 6: 133,851,916 probably null Het
Ly96 A G 1: 16,700,867 E74G probably damaging Het
Map7d1 G T 4: 126,242,304 probably null Het
Megf6 G T 4: 154,252,523 R253L probably benign Het
Mex3b A G 7: 82,869,251 D258G probably damaging Het
Mpzl3 T C 9: 45,062,110 I49T possibly damaging Het
Myh15 C A 16: 49,101,507 T472N probably benign Het
Nacad A G 11: 6,601,611 S527P probably damaging Het
Nkx2-3 T G 19: 43,612,708 S70A probably benign Het
Nkx2-6 A T 14: 69,171,893 Q31L probably benign Het
Olfr522 A G 7: 140,162,719 V77A probably damaging Het
Pcdha6 A T 18: 36,968,791 N346Y probably damaging Het
Pkd2 G A 5: 104,459,919 D95N probably benign Het
Pkhd1l1 A G 15: 44,547,148 T2684A probably damaging Het
Plin2 A G 4: 86,657,146 Y389H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc41a2 T C 10: 83,313,411 probably null Het
Smg6 A G 11: 75,041,996 T1038A probably damaging Het
Suds3 T C 5: 117,100,599 probably benign Het
Tbc1d8 T C 1: 39,385,132 H626R probably benign Het
Trip10 A T 17: 57,261,288 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Vmn1r84 A T 7: 12,362,458 S103T probably benign Het
Vps13a G T 19: 16,685,315 P1602Q probably damaging Het
Other mutations in Tmem260
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Tmem260 APN 14 48486879 missense probably benign 0.27
IGL00338:Tmem260 APN 14 48477636 missense probably damaging 0.97
IGL00508:Tmem260 APN 14 48509121 missense probably damaging 0.99
IGL01308:Tmem260 APN 14 48511958 missense probably damaging 1.00
IGL01548:Tmem260 APN 14 48480325 missense possibly damaging 0.60
IGL01952:Tmem260 APN 14 48472476 missense probably damaging 1.00
IGL03068:Tmem260 APN 14 48486914 splice site probably benign
IGL03081:Tmem260 APN 14 48496293 missense probably benign 0.14
R0131:Tmem260 UTSW 14 48483322 nonsense probably null
R0131:Tmem260 UTSW 14 48483322 nonsense probably null
R0132:Tmem260 UTSW 14 48483322 nonsense probably null
R0149:Tmem260 UTSW 14 48452047 missense possibly damaging 0.88
R0361:Tmem260 UTSW 14 48452047 missense possibly damaging 0.88
R0396:Tmem260 UTSW 14 48486867 missense possibly damaging 0.83
R0524:Tmem260 UTSW 14 48472478 missense probably benign 0.00
R1734:Tmem260 UTSW 14 48509093 missense probably benign 0.00
R2152:Tmem260 UTSW 14 48477609 missense possibly damaging 0.62
R2474:Tmem260 UTSW 14 48496324 missense probably null 0.90
R2928:Tmem260 UTSW 14 48486750 missense probably damaging 1.00
R2999:Tmem260 UTSW 14 48484989 missense possibly damaging 0.92
R3030:Tmem260 UTSW 14 48485001 missense probably damaging 1.00
R4273:Tmem260 UTSW 14 48505304 missense probably benign 0.11
R4276:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4277:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4278:Tmem260 UTSW 14 48477636 missense probably damaging 0.97
R4791:Tmem260 UTSW 14 48511994 intron probably benign
R4792:Tmem260 UTSW 14 48511994 intron probably benign
R4810:Tmem260 UTSW 14 48472473 missense probably damaging 0.99
R5280:Tmem260 UTSW 14 48505259 missense probably benign 0.02
R5289:Tmem260 UTSW 14 48486810 missense possibly damaging 0.79
R5322:Tmem260 UTSW 14 48486849 missense probably damaging 0.99
R5491:Tmem260 UTSW 14 48512170 intron probably null
R5593:Tmem260 UTSW 14 48474044 missense probably benign 0.38
R5606:Tmem260 UTSW 14 48484980 missense probably damaging 1.00
R5824:Tmem260 UTSW 14 48505328 missense probably damaging 1.00
R5947:Tmem260 UTSW 14 48486801 missense possibly damaging 0.93
R6587:Tmem260 UTSW 14 48496456 unclassified probably null
R7234:Tmem260 UTSW 14 48505329 nonsense probably null
R7236:Tmem260 UTSW 14 48509190 intron probably null
R7836:Tmem260 UTSW 14 48509062 missense probably benign 0.04
R7919:Tmem260 UTSW 14 48509062 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CACAGTGATGAGCCTTTTCCC -3'
(R):5'- GACCCTTAGCTTCAACACTGTTTG -3'

Sequencing Primer
(F):5'- GTGATGAGCCTTTTCCCAAAAC -3'
(R):5'- TGTGACACAACTGAATGCTCTC -3'
Posted On2016-07-22