Incidental Mutation 'R5328:Sorbs3'
ID422172
Institutional Source Beutler Lab
Gene Symbol Sorbs3
Ensembl Gene ENSMUSG00000022091
Gene Namesorbin and SH3 domain containing 3
SynonymsSH3P3, Sh3d4, vinexin beta, vinexin alpha
MMRRC Submission 042843-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5328 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location70180468-70211989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70181174 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 680 (V680E)
Ref Sequence ENSEMBL: ENSMUSP00000154195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022681] [ENSMUST00000022682] [ENSMUST00000153735] [ENSMUST00000227259] [ENSMUST00000227653] [ENSMUST00000227929]
Predicted Effect probably benign
Transcript: ENSMUST00000022681
SMART Domains Protein: ENSMUSP00000022681
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
Pfam:DUF4749 169 256 4.4e-12 PFAM
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000022682
AA Change: V733E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022682
Gene: ENSMUSG00000022091
AA Change: V733E

DomainStartEndE-ValueType
Sorb 165 214 6.87e-30 SMART
SH3 447 502 9.24e-21 SMART
SH3 521 578 4.18e-19 SMART
low complexity region 597 613 N/A INTRINSIC
SH3 677 733 8.31e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141363
Predicted Effect probably benign
Transcript: ENSMUST00000153735
SMART Domains Protein: ENSMUSP00000116200
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 241 250 N/A INTRINSIC
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000227259
AA Change: V680E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227653
AA Change: V680E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227929
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an SH3 domain-containing adaptor protein. The presence of SH3 domains play a role in this protein's ability to bind other cytoplasmic molecules and contribute to cystoskeletal organization, cell adhesion and migration, signaling, and gene expression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutants are generally normal, viable, and fertile, except showing delayed wound healing in response to full-thickness skin injury in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,837,694 V860E possibly damaging Het
Abcc6 T C 7: 45,992,311 D881G probably benign Het
Abcc9 A G 6: 142,682,059 V415A probably benign Het
Adgrb3 A C 1: 25,094,275 N1003K possibly damaging Het
Adora3 C T 3: 105,907,303 T123I probably benign Het
Amotl2 A C 9: 102,723,768 T345P probably benign Het
Arap3 C T 18: 37,991,687 E247K possibly damaging Het
Atp8b1 A T 18: 64,531,391 D1235E probably benign Het
Axl A T 7: 25,773,411 V400E probably damaging Het
Brd8 T A 18: 34,607,981 N431Y probably benign Het
Cadps A T 14: 12,457,790 N1025K probably benign Het
Cblc A T 7: 19,792,580 S195T possibly damaging Het
Chd2 C T 7: 73,463,681 A1184T possibly damaging Het
Chst10 G A 1: 38,895,962 probably benign Het
Col12a1 T C 9: 79,620,060 K2663E probably damaging Het
Cspg4 A T 9: 56,885,856 I292L probably benign Het
Cul1 T C 6: 47,508,317 V294A probably damaging Het
Cyp2d11 G A 15: 82,391,771 P203L probably benign Het
Dscam T C 16: 96,673,678 H1228R probably benign Het
Eif3l A T 15: 79,093,361 K534* probably null Het
Enpep T C 3: 129,280,510 E796G probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam117a T A 11: 95,364,170 probably null Het
Fan1 A T 7: 64,354,469 Y750N probably damaging Het
Fat4 T A 3: 38,956,868 I2039N probably damaging Het
Gabrr2 G T 4: 33,082,565 D106Y probably damaging Het
Gak A C 5: 108,617,001 C145G possibly damaging Het
Galnt14 A T 17: 73,505,459 N406K possibly damaging Het
Gm10439 T G X: 149,636,163 *434E probably null Het
Gm10837 G T 14: 122,490,778 R22L unknown Het
Gm19965 T A 1: 116,821,418 H276Q possibly damaging Het
Gm43517 T C 12: 49,391,156 probably benign Het
Gm9733 T C 3: 15,332,174 M17V unknown Het
Greb1l A T 18: 10,553,720 I1574F probably damaging Het
Gzme G A 14: 56,117,767 H236Y probably benign Het
Heatr5b G A 17: 78,826,362 T266I possibly damaging Het
Hk3 T C 13: 55,013,493 I185V probably benign Het
Hnrnpr A G 4: 136,339,216 E302G probably benign Het
Itgal T C 7: 127,311,675 probably null Het
Itk A G 11: 46,331,876 S583P probably benign Het
Loxhd1 A T 18: 77,410,572 I1448F probably damaging Het
Macf1 GCCCCC GCCCCCC 4: 123,350,991 probably null Het
Man2a2 A T 7: 80,368,756 F118L probably benign Het
Mfsd5 T A 15: 102,281,012 V273E probably damaging Het
Nfe2l2 A G 2: 75,676,856 L300P probably damaging Het
Nt5c1a T G 4: 123,208,993 L122R possibly damaging Het
Nt5c3b A G 11: 100,440,241 F42S probably damaging Het
Olfr332 C A 11: 58,490,429 A109S possibly damaging Het
Olfr577 T A 7: 102,973,968 N8I possibly damaging Het
Pabpc1 A T 15: 36,602,877 D204E probably benign Het
Panx2 A G 15: 89,068,095 N255S probably damaging Het
Pcnt A G 10: 76,411,719 L993P probably damaging Het
Pfas A T 11: 68,988,592 C1160S probably damaging Het
Plekhh3 T A 11: 101,167,658 probably benign Het
Plod3 T A 5: 136,989,683 N258K probably damaging Het
Prr14l T C 5: 32,830,021 Q710R probably benign Het
Rnf216 G T 5: 143,092,999 T65K possibly damaging Het
Samd9l T C 6: 3,376,739 E174G probably damaging Het
Sept12 T A 16: 4,993,993 M63L possibly damaging Het
Sh3bgrl2 T A 9: 83,577,456 D22E probably benign Het
Skil A G 3: 31,117,569 K488R probably benign Het
Slamf6 T A 1: 171,938,095 I262K probably benign Het
Slc27a3 T C 3: 90,386,832 D470G probably damaging Het
Sox9 C T 11: 112,782,658 T25I probably benign Het
Srsf1 G T 11: 88,049,993 probably benign Het
Stard9 A C 2: 120,699,230 E1989D probably damaging Het
Thumpd2 T A 17: 81,044,162 I277F possibly damaging Het
Tinag C A 9: 77,005,631 G299* probably null Het
Tk2 A T 8: 104,229,299 probably null Het
Tmem44 A G 16: 30,540,891 S210P possibly damaging Het
Traf3ip1 C A 1: 91,520,069 P423T probably damaging Het
Trmt12 A G 15: 58,872,855 D34G probably damaging Het
Ttc39b A G 4: 83,261,941 Y72H probably damaging Het
Ttn G A 2: 76,878,411 probably benign Het
Ttyh2 T A 11: 114,710,068 I381N possibly damaging Het
Uaca A T 9: 60,870,532 N734Y probably benign Het
Usp34 T C 11: 23,464,616 I2853T probably benign Het
Usp34 G A 11: 23,488,659 G3407D probably benign Het
Vmn2r78 A G 7: 86,921,030 Y252C probably damaging Het
Wdr19 G A 5: 65,244,179 C979Y probably damaging Het
Wdr92 C A 11: 17,222,220 P103Q probably damaging Het
Yeats2 A T 16: 20,171,205 H277L probably damaging Het
Zbtb2 T C 10: 4,369,267 Y253C possibly damaging Het
Zfat C A 15: 68,179,828 G706C probably damaging Het
Zfp106 A T 2: 120,520,417 N1584K possibly damaging Het
Other mutations in Sorbs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Sorbs3 APN 14 70191155 missense probably damaging 1.00
IGL01144:Sorbs3 APN 14 70191568 missense probably benign 0.04
IGL01155:Sorbs3 APN 14 70199341 missense probably damaging 1.00
IGL01465:Sorbs3 APN 14 70195509 splice site probably benign
IGL02184:Sorbs3 APN 14 70184006 critical splice donor site probably null
R0544:Sorbs3 UTSW 14 70193926 missense probably benign 0.01
R0882:Sorbs3 UTSW 14 70207572 missense probably damaging 1.00
R1445:Sorbs3 UTSW 14 70193646 missense probably benign 0.12
R1493:Sorbs3 UTSW 14 70192627 missense possibly damaging 0.71
R1505:Sorbs3 UTSW 14 70190802 nonsense probably null
R1671:Sorbs3 UTSW 14 70191466 missense possibly damaging 0.92
R2184:Sorbs3 UTSW 14 70191431 critical splice donor site probably null
R3804:Sorbs3 UTSW 14 70199351 splice site probably benign
R4527:Sorbs3 UTSW 14 70207617 missense probably damaging 1.00
R4755:Sorbs3 UTSW 14 70184099 missense probably benign 0.00
R4926:Sorbs3 UTSW 14 70186945 missense probably damaging 1.00
R5257:Sorbs3 UTSW 14 70185034 missense probably benign 0.00
R5304:Sorbs3 UTSW 14 70184896 nonsense probably null
R5684:Sorbs3 UTSW 14 70181222 missense probably damaging 1.00
R5988:Sorbs3 UTSW 14 70203303 missense probably benign 0.03
R6106:Sorbs3 UTSW 14 70192604 splice site probably null
R7207:Sorbs3 UTSW 14 70201485 missense probably damaging 1.00
R7562:Sorbs3 UTSW 14 70207527 missense probably benign 0.00
R7831:Sorbs3 UTSW 14 70203032 missense possibly damaging 0.93
R7893:Sorbs3 UTSW 14 70193916 missense probably benign 0.35
R7914:Sorbs3 UTSW 14 70203032 missense possibly damaging 0.93
R7976:Sorbs3 UTSW 14 70193916 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GGTGGGAATCGGACTTCAAG -3'
(R):5'- CGGAGTTAGTGCTGTGCAAAG -3'

Sequencing Primer
(F):5'- ATCGGACTTCAAGGAGGCTTG -3'
(R):5'- AGAAGTGCAGCGTTGTTTGTACC -3'
Posted On2016-08-04