Incidental Mutation 'R5355:Mfn2'
ID424030
Institutional Source Beutler Lab
Gene Symbol Mfn2
Ensembl Gene ENSMUSG00000029020
Gene Namemitofusin 2
Synonymshypertension related protein 1, D630023P19Rik, Fzo
MMRRC Submission 042934-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5355 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location147873599-147904704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 147894578 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 99 (V99A)
Ref Sequence ENSEMBL: ENSMUSP00000123021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030884] [ENSMUST00000105714] [ENSMUST00000105715] [ENSMUST00000105716] [ENSMUST00000134172] [ENSMUST00000150881]
Predicted Effect probably damaging
Transcript: ENSMUST00000030884
AA Change: V99A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030884
Gene: ENSMUSG00000029020
AA Change: V99A

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 3.8e-6 PFAM
Pfam:Dynamin_N 99 259 2e-24 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Pfam:Fzo_mitofusin 594 754 1.6e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105714
AA Change: V99A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101339
Gene: ENSMUSG00000029020
AA Change: V99A

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 6.1e-7 PFAM
Pfam:Dynamin_N 99 259 3.6e-25 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105715
AA Change: V99A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101340
Gene: ENSMUSG00000029020
AA Change: V99A

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 9e-7 PFAM
Pfam:Dynamin_N 99 259 5.4e-25 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Pfam:Fzo_mitofusin 586 756 3.9e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105716
AA Change: V99A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101341
Gene: ENSMUSG00000029020
AA Change: V99A

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 9e-7 PFAM
Pfam:Dynamin_N 99 259 5.4e-25 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Pfam:Fzo_mitofusin 586 756 3.9e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118348
Predicted Effect probably damaging
Transcript: ENSMUST00000134172
AA Change: V99A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123021
Gene: ENSMUSG00000029020
AA Change: V99A

DomainStartEndE-ValueType
Pfam:Dynamin_N 99 208 5.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150881
Meta Mutation Damage Score 0.4077 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell proliferation, and it may play a role in the pathophysiology of obesity. Mutations in this gene cause Charcot-Marie-Tooth disease type 2A2, and hereditary motor and sensory neuropathy VI, which are both disorders of the peripheral nervous system. Defects in this gene have also been associated with early-onset stroke. Two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die in mid-gestation. Structural and functional abnormalities of mitochondria are reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T C 5: 8,726,873 L857P probably damaging Het
Adam12 T C 7: 133,887,942 *582W probably null Het
Adra1d A G 2: 131,561,087 V361A probably damaging Het
Ank2 A G 3: 126,944,049 probably benign Het
Atxn10 T A 15: 85,462,314 N424K probably damaging Het
C8b A G 4: 104,780,663 T111A probably benign Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cdr2l T C 11: 115,393,570 V244A possibly damaging Het
Col11a2 A G 17: 34,051,801 M468V probably benign Het
Col4a2 G A 8: 11,445,984 R1535H probably damaging Het
Cryab A T 9: 50,753,451 S59C probably damaging Het
Cuzd1 G A 7: 131,316,124 T249I probably damaging Het
Disp2 G A 2: 118,786,911 V129M probably benign Het
Dlg2 G T 7: 91,449,803 R31L probably benign Het
Dthd1 A C 5: 62,839,387 L488F probably damaging Het
Dupd1 G A 14: 21,677,023 R186W probably benign Het
Fat2 T G 11: 55,282,166 I2574L probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl T C 5: 73,073,904 D1610G probably damaging Het
Gm10330 T A 12: 23,780,130 N17Y probably damaging Het
Gm4787 T A 12: 81,377,465 R640* probably null Het
Gm8251 A C 1: 44,057,979 C1320G possibly damaging Het
Hist1h2bl A T 13: 21,715,860 I95N probably damaging Het
Ift88 T A 14: 57,438,242 S71T probably benign Het
Isoc2b A G 7: 4,849,358 probably benign Het
Itgb2 G T 10: 77,558,052 R442L probably benign Het
Lama5 A T 2: 180,181,651 N2658K possibly damaging Het
Lemd3 A T 10: 120,933,633 I598K probably damaging Het
Lrp2 A T 2: 69,454,838 C3825* probably null Het
Mep1a T C 17: 43,477,146 D673G probably damaging Het
Met A G 6: 17,491,362 Y41C probably damaging Het
Mmadhc A G 2: 50,291,424 I78T probably benign Het
Mmp9 C A 2: 164,950,992 P389T possibly damaging Het
Mvk T G 5: 114,452,438 S7A probably damaging Het
Nlrp1a T A 11: 71,124,251 T58S probably benign Het
Nlrp1c-ps C A 11: 71,258,013 noncoding transcript Het
Nr1h3 A G 2: 91,191,908 I125T possibly damaging Het
Olfr1089 A T 2: 86,733,336 I92K probably damaging Het
Olfr443-ps1 C T 6: 43,094,664 noncoding transcript Het
Parn A G 16: 13,668,022 I3T possibly damaging Het
Parp8 A G 13: 116,862,204 probably null Het
Parva T C 7: 112,544,268 probably null Het
Pwp2 A C 10: 78,175,544 I672M possibly damaging Het
Sfswap C T 5: 129,539,746 T418I probably benign Het
Slc6a3 A G 13: 73,560,959 Y334C probably damaging Het
Slc7a13 C A 4: 19,839,267 T290K probably benign Het
Spry2 A G 14: 105,893,278 L158P probably damaging Het
Usp25 A G 16: 77,050,454 E150G probably damaging Het
Zfp747 A G 7: 127,374,597 F134L possibly damaging Het
Zp3r A G 1: 130,596,781 F175S probably benign Het
Zscan22 C A 7: 12,906,508 N67K probably benign Het
Other mutations in Mfn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Mfn2 APN 4 147885490 missense probably damaging 1.00
IGL03236:Mfn2 APN 4 147882105 missense probably damaging 1.00
milkshake UTSW 4 147887452 missense probably benign 0.12
R0066:Mfn2 UTSW 4 147885445 unclassified probably benign
R0066:Mfn2 UTSW 4 147885445 unclassified probably benign
R0326:Mfn2 UTSW 4 147883288 missense probably damaging 1.00
R0376:Mfn2 UTSW 4 147885526 missense probably benign 0.24
R0564:Mfn2 UTSW 4 147883255 missense probably damaging 1.00
R0962:Mfn2 UTSW 4 147882201 missense probably benign
R1595:Mfn2 UTSW 4 147894696 missense probably benign 0.08
R2105:Mfn2 UTSW 4 147888705 nonsense probably null
R2260:Mfn2 UTSW 4 147894606 nonsense probably null
R4544:Mfn2 UTSW 4 147887452 missense probably benign 0.12
R4546:Mfn2 UTSW 4 147887452 missense probably benign 0.12
R4561:Mfn2 UTSW 4 147877035 missense probably damaging 1.00
R5151:Mfn2 UTSW 4 147886328 missense probably benign 0.10
R6645:Mfn2 UTSW 4 147894612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGAAAGTAGATGTGTGCTCC -3'
(R):5'- AGTCAACAGAGGTGGTCTTGTG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- TGTGGGAGATGGAGACTGTCAG -3'
Posted On2016-08-04