Incidental Mutation 'R5458:Pdzd7'
ID432904
Institutional Source Beutler Lab
Gene Symbol Pdzd7
Ensembl Gene ENSMUSG00000074818
Gene NamePDZ domain containing 7
SynonymsPdzk7, EG435601
MMRRC Submission 043021-MU
Accession Numbers

Genbank: NM_001195265

Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location45026906-45046614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45027791 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 964 (S964G)
Ref Sequence ENSEMBL: ENSMUSP00000133273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039016] [ENSMUST00000145391] [ENSMUST00000169459] [ENSMUST00000178087] [ENSMUST00000179108]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000038901
Predicted Effect probably benign
Transcript: ENSMUST00000039016
SMART Domains Protein: ENSMUSP00000045478
Gene: ENSMUSG00000035342

DomainStartEndE-ValueType
low complexity region 99 105 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 267 321 N/A INTRINSIC
low complexity region 375 407 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
Pfam:Fez1 441 639 4.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145391
AA Change: S964G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119002
Gene: ENSMUSG00000074818
AA Change: S964G

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169459
AA Change: S964G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133273
Gene: ENSMUSG00000074818
AA Change: S964G

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PDZ 95 167 3.51e-19 SMART
PDZ 220 292 2.47e-14 SMART
low complexity region 319 344 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 768 809 N/A INTRINSIC
low complexity region 812 824 N/A INTRINSIC
PDZ 866 947 1.96e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178087
SMART Domains Protein: ENSMUSP00000136405
Gene: ENSMUSG00000035342

DomainStartEndE-ValueType
low complexity region 99 105 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 267 321 N/A INTRINSIC
low complexity region 375 407 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
Pfam:Fez1 441 638 2.2e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179108
SMART Domains Protein: ENSMUSP00000137571
Gene: ENSMUSG00000035342

DomainStartEndE-ValueType
low complexity region 99 105 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 267 321 N/A INTRINSIC
low complexity region 375 407 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
Pfam:Fez1 441 639 4.2e-82 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary protein homologous to proteins which are mutated in Usher syndrome patients, and mutations and translocations involving this gene have been associated with two types of Usher syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit profound deafness due to abnormal outer cochlear hair cell morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp A G 6: 125,050,050 probably benign Het
Acsl5 A G 19: 55,294,230 D589G probably damaging Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankfn1 C T 11: 89,434,810 R512K probably benign Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp2c1 A T 9: 105,414,725 Y709* probably null Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Brca1 T C 11: 101,517,285 N1404S possibly damaging Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Chek1 A G 9: 36,714,429 S307P probably benign Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fggy A G 4: 95,926,743 Q445R probably benign Het
Fv1 A G 4: 147,870,269 S431G probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Gnas A G 2: 174,298,331 I98V probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lclat1 T C 17: 73,239,919 L277P probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Nlgn2 G T 11: 69,827,900 Q285K possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Scmh1 C T 4: 120,505,281 probably benign Het
Skint2 A G 4: 112,624,180 H80R possibly damaging Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Srpk1 T C 17: 28,599,472 probably null Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trappc12 A G 12: 28,746,390 V381A probably damaging Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wdr95 C T 5: 149,564,414 P171L probably damaging Het
Wsb1 T C 11: 79,248,436 T75A probably damaging Het
Other mutations in Pdzd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Pdzd7 APN 19 45040258 missense probably damaging 1.00
IGL02729:Pdzd7 APN 19 45045643 start codon destroyed probably null 0.89
F6893:Pdzd7 UTSW 19 45036734 missense probably damaging 0.98
R0211:Pdzd7 UTSW 19 45033667 missense possibly damaging 0.72
R0211:Pdzd7 UTSW 19 45033667 missense possibly damaging 0.72
R0295:Pdzd7 UTSW 19 45037072 missense probably benign 0.01
R0523:Pdzd7 UTSW 19 45036090 missense probably benign 0.01
R0645:Pdzd7 UTSW 19 45045475 missense possibly damaging 0.95
R0731:Pdzd7 UTSW 19 45029305 missense probably damaging 1.00
R1265:Pdzd7 UTSW 19 45040685 missense possibly damaging 0.64
R1711:Pdzd7 UTSW 19 45045511 missense possibly damaging 0.68
R1789:Pdzd7 UTSW 19 45039228 missense probably damaging 1.00
R1817:Pdzd7 UTSW 19 45036176 missense probably damaging 0.98
R2162:Pdzd7 UTSW 19 45036055 critical splice donor site probably null
R2851:Pdzd7 UTSW 19 45027674 missense probably benign
R2852:Pdzd7 UTSW 19 45027674 missense probably benign
R2939:Pdzd7 UTSW 19 45045423 missense possibly damaging 0.89
R3832:Pdzd7 UTSW 19 45040254 missense probably damaging 1.00
R3874:Pdzd7 UTSW 19 45045628 missense probably benign
R4416:Pdzd7 UTSW 19 45040580 missense probably damaging 1.00
R4668:Pdzd7 UTSW 19 45045687 start gained probably benign
R5133:Pdzd7 UTSW 19 45028429 missense possibly damaging 0.51
R5327:Pdzd7 UTSW 19 45028777 missense probably benign
R5480:Pdzd7 UTSW 19 45039285 missense possibly damaging 0.65
R5644:Pdzd7 UTSW 19 45040180 missense probably benign 0.16
R5799:Pdzd7 UTSW 19 45036989 missense probably benign 0.06
R5812:Pdzd7 UTSW 19 45036871 missense probably damaging 1.00
R5873:Pdzd7 UTSW 19 45027949 missense probably damaging 1.00
R6669:Pdzd7 UTSW 19 45036751 missense possibly damaging 0.94
R6750:Pdzd7 UTSW 19 45027748 missense probably benign
R7128:Pdzd7 UTSW 19 45027949 missense probably damaging 0.99
R7183:Pdzd7 UTSW 19 45037114 missense probably benign
R7378:Pdzd7 UTSW 19 45045606 missense probably damaging 0.99
R7395:Pdzd7 UTSW 19 45037011 missense probably damaging 1.00
R7426:Pdzd7 UTSW 19 45033647 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CAGGAGGACTTGAGGTCACTAG -3'
(R):5'- GAATATTCCATCTCTGTGCCAGG -3'

Sequencing Primer
(F):5'- CTTGAGGTCACTAGGAAGGGTC -3'
(R):5'- CCAGGCTGGCTTTGAGCTG -3'
Posted On2016-10-06