Incidental Mutation 'R5472:Inhba'
ID433884
Institutional Source Beutler Lab
Gene Symbol Inhba
Ensembl Gene ENSMUSG00000041324
Gene Nameinhibin beta-A
Synonymsactivin
MMRRC Submission 043033-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5472 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location16011851-16031621 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16026786 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 311 (E311G)
Ref Sequence ENSEMBL: ENSMUSP00000132085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042603] [ENSMUST00000164993]
Predicted Effect probably damaging
Transcript: ENSMUST00000042603
AA Change: E311G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047894
Gene: ENSMUSG00000041324
AA Change: E311G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TGFb_propeptide 37 294 9.5e-20 PFAM
TGFB 319 424 1.3e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164993
AA Change: E311G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132085
Gene: ENSMUSG00000041324
AA Change: E311G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TGFb_propeptide 45 293 3.8e-12 PFAM
TGFB 319 424 1.3e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223477
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate a subunit of the dimeric activin and inhibin protein complexes. These complexes activate and inhibit, respectively, follicle stimulating hormone secretion from the pituitary gland. The encoded protein also plays a role in eye, tooth and testis development. Homozygous knockout mice for this gene lack whiskers and exhibit tooth and palate defects, leading to neonatal lethality. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a targeted null mutation lack vibrissae and lower incisors, have defects in their secondary palates, and die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,513,429 N506S probably benign Het
BC067074 A G 13: 113,319,169 D583G probably benign Het
Brinp3 A T 1: 146,901,459 H548L possibly damaging Het
Cacna1c A G 6: 118,638,446 V1328A possibly damaging Het
Carmil1 C T 13: 24,155,471 V47I probably damaging Het
Cdk2ap2 C A 19: 4,098,048 T76K probably benign Het
Col16a1 T C 4: 130,092,771 probably benign Het
Cxcr4 C A 1: 128,589,625 A100S probably damaging Het
Fancl G T 11: 26,469,677 C305F probably damaging Het
Gcnt2 T C 13: 40,953,579 V308A probably benign Het
Gm11733 A T 11: 117,484,496 I24L unknown Het
Gm765 A T 6: 98,238,276 C129S probably damaging Het
Gm973 A G 1: 59,628,287 probably null Het
Gm996 T C 2: 25,579,702 T66A probably benign Het
Heatr5b A T 17: 78,801,660 F1057I probably damaging Het
Ifi213 A T 1: 173,567,272 probably null Het
Ighv1-20 A T 12: 114,723,851 V91E probably damaging Het
Irx3 G T 8: 91,799,480 probably null Het
Jag1 C A 2: 137,084,995 C948F probably damaging Het
Kcna2 T C 3: 107,105,309 I402T possibly damaging Het
Kcnh8 A T 17: 52,977,816 Q938L possibly damaging Het
Lrsam1 ACC AC 2: 32,945,858 probably null Het
Macf1 T C 4: 123,450,061 T2123A probably benign Het
Mdh1 A T 11: 21,559,786 N196K probably benign Het
Msh6 G A 17: 87,984,561 R248Q possibly damaging Het
Odf2l G T 3: 145,146,866 R457L probably benign Het
Olfr822 A T 10: 130,075,029 L206F probably damaging Het
Pphln1 T C 15: 93,488,975 V318A possibly damaging Het
Ppp1r12a C T 10: 108,240,112 T267I probably damaging Het
Pramef20 T C 4: 144,377,157 D133G probably benign Het
Prpf8 A C 11: 75,503,643 K1801N possibly damaging Het
Raf1 A G 6: 115,626,706 probably null Het
Rasal3 C A 17: 32,396,669 L374F probably damaging Het
S1pr3 T A 13: 51,419,647 V288D probably damaging Het
Setd7 G A 3: 51,521,465 P315S probably benign Het
Slx4 C T 16: 3,991,540 A364T probably benign Het
Sp7 G A 15: 102,359,314 T19I probably benign Het
Tlr9 T A 9: 106,224,313 C268S probably damaging Het
Tmem117 T A 15: 95,094,513 D351E possibly damaging Het
Tmem45b T A 9: 31,428,044 D211V possibly damaging Het
Tns3 A G 11: 8,451,092 S1069P probably benign Het
Tsnax A G 8: 125,015,762 I77V probably benign Het
Txndc5 G A 13: 38,513,125 L79F possibly damaging Het
Ube2q1 A G 3: 89,777,241 E14G probably benign Het
Vmn2r28 C T 7: 5,487,944 probably null Het
Vwde A T 6: 13,193,118 D407E probably benign Het
Wdr35 T A 12: 9,016,619 M749K probably benign Het
Zfp109 A T 7: 24,228,621 C462* probably null Het
Other mutations in Inhba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Inhba APN 13 16026972 missense probably benign 0.00
IGL02666:Inhba APN 13 16027079 missense possibly damaging 0.87
IGL03138:Inhba UTSW 13 16017514 missense probably benign
R0020:Inhba UTSW 13 16026364 missense possibly damaging 0.46
R0591:Inhba UTSW 13 16026820 missense probably damaging 1.00
R1510:Inhba UTSW 13 16027022 missense probably damaging 0.99
R1667:Inhba UTSW 13 16026624 missense possibly damaging 0.90
R1966:Inhba UTSW 13 16026636 missense probably damaging 1.00
R4710:Inhba UTSW 13 16026483 missense probably benign
R4893:Inhba UTSW 13 16026549 missense possibly damaging 0.61
R5905:Inhba UTSW 13 16017308 missense probably benign 0.05
R7555:Inhba UTSW 13 16017637 missense probably benign 0.28
R7965:Inhba UTSW 13 16026987 missense possibly damaging 0.75
R8031:Inhba UTSW 13 16026275 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GTGCCAGTCTAGTGCTTCTG -3'
(R):5'- CAGCATGACTTAAGGTTGGCAAAG -3'

Sequencing Primer
(F):5'- CAGTCTAGTGCTTCTGGGCAAG -3'
(R):5'- CCTCATGCGGTAGTGGTTAATGAC -3'
Posted On2016-10-06