Incidental Mutation 'R5560:Mical1'
ID 501194
Institutional Source Beutler Lab
Gene Symbol Mical1
Ensembl Gene ENSMUSG00000019823
Gene Name microtubule associated monooxygenase, calponin and LIM domain containing 1
Synonyms Nical
MMRRC Submission 043117-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock # R5560 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 41476314-41487032 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41478965 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 157 (I157F)
Ref Sequence ENSEMBL: ENSMUSP00000114969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019967] [ENSMUST00000099934] [ENSMUST00000119962] [ENSMUST00000126436] [ENSMUST00000151486]
AlphaFold Q8VDP3
Predicted Effect probably damaging
Transcript: ENSMUST00000019967
AA Change: I157F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019967
Gene: ENSMUSG00000019823
AA Change: I157F

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 5.5e-8 PFAM
Pfam:FAD_binding_2 86 125 6.1e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099934
SMART Domains Protein: ENSMUSP00000097519
Gene: ENSMUSG00000019823

DomainStartEndE-ValueType
PDB:2C4C|B 1 86 5e-49 PDB
low complexity region 87 98 N/A INTRINSIC
PDB:2C4C|B 99 416 N/A PDB
CH 436 533 4.18e-13 SMART
low complexity region 576 593 N/A INTRINSIC
LIM 609 663 2.07e-3 SMART
low complexity region 693 712 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 782 804 N/A INTRINSIC
DUF3585 839 975 3.07e-44 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119962
AA Change: I157F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113783
Gene: ENSMUSG00000019823
AA Change: I157F

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 7.2e-8 PFAM
Pfam:FAD_binding_2 86 125 3.8e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125730
Predicted Effect probably damaging
Transcript: ENSMUST00000126436
AA Change: I157F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114969
Gene: ENSMUSG00000019823
AA Change: I157F

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 1.1e-7 PFAM
Pfam:FAD_binding_2 86 125 3.2e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136681
Predicted Effect probably benign
Transcript: ENSMUST00000151486
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that oxidizes methionine residues on actin, thereby promoting depolymerization of actin filaments. This protein interacts with and regulates signalling by NEDD9/CAS-L (neural precursor cell expressed, developmentally down-regulated 9). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adipor1 T C 1: 134,426,040 W188R possibly damaging Het
Agrn T C 4: 156,178,497 D441G probably damaging Het
Ankrd55 T C 13: 112,383,490 S570P probably benign Het
Ano9 C G 7: 141,110,482 G80R probably damaging Het
Arhgef2 T A 3: 88,634,437 V250E probably damaging Het
Atp2b2 T C 6: 113,774,358 D583G possibly damaging Het
Bcar3 T A 3: 122,426,575 D40E possibly damaging Het
Capn12 A G 7: 28,882,860 D133G probably benign Het
Ccna1 A T 3: 55,048,569 Y269N probably damaging Het
Cct6b A T 11: 82,741,413 Y250N probably damaging Het
Cep112 A C 11: 108,437,235 K98Q probably damaging Het
Chst13 T C 6: 90,318,269 D54G probably damaging Het
Clstn2 G T 9: 97,469,819 H518N possibly damaging Het
Cntnap1 T A 11: 101,182,435 L581M probably damaging Het
Cog3 T A 14: 75,729,393 M446L probably damaging Het
D430042O09Rik T C 7: 125,854,561 V1150A probably benign Het
Dennd2c T A 3: 103,161,555 I756K probably damaging Het
Dennd3 T G 15: 73,532,895 L273R probably damaging Het
Dhx34 C A 7: 16,218,541 R53L probably benign Het
Dnah9 G A 11: 65,881,740 T3722I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dusp6 A G 10: 99,266,241 Y217C probably damaging Het
Dyrk1b G A 7: 28,184,253 R178Q possibly damaging Het
Eif4g1 T A 16: 20,686,895 C1009S probably benign Het
Fam198a T C 9: 121,978,223 F478L possibly damaging Het
Frmpd1 A T 4: 45,243,697 T57S probably damaging Het
Gjc2 A G 11: 59,177,359 V99A possibly damaging Het
Gm9955 A T 18: 24,709,092 probably benign Het
Gpr158 A G 2: 21,826,290 I734V possibly damaging Het
Herc1 A T 9: 66,451,119 H2494L probably benign Het
Hist1h1c A G 13: 23,739,407 S187G probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmgcs1 A G 13: 119,699,815 probably null Het
Invs A T 4: 48,416,084 T655S probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Kcnj6 A T 16: 94,832,965 L96M probably benign Het
Lfng A G 5: 140,614,267 D354G possibly damaging Het
Lgsn T C 1: 31,196,872 L139P probably damaging Het
Madd C A 2: 91,163,545 V923L probably damaging Het
Mfsd7a A T 5: 108,448,863 M1K probably null Het
Mis18bp1 T C 12: 65,152,816 N154S possibly damaging Het
Mrps14 A G 1: 160,195,535 K6R probably benign Het
Mug1 T A 6: 121,861,073 C421S probably damaging Het
Myo18b A G 5: 112,868,295 I696T probably damaging Het
Naf1 T C 8: 66,883,545 Y375H probably damaging Het
Nsf T A 11: 103,863,255 E485V possibly damaging Het
Nup188 A G 2: 30,309,885 D307G probably damaging Het
Ocel1 C A 8: 71,372,478 P108T probably damaging Het
Oip5 A G 2: 119,613,059 S177P probably damaging Het
Olfr1436 G A 19: 12,298,644 Q163* probably null Het
Olfr365 A G 2: 37,201,930 I230V probably benign Het
Olfr51 A C 11: 51,007,523 I184L possibly damaging Het
Olfr943 A C 9: 39,184,184 E2A probably benign Het
Omg A G 11: 79,501,758 W425R possibly damaging Het
Pikfyve A G 1: 65,253,407 Y1339C probably damaging Het
Polr3e A G 7: 120,922,949 D6G possibly damaging Het
Pou4f3 C A 18: 42,395,415 P141Q probably benign Het
Rcsd1 T A 1: 165,655,501 N337I possibly damaging Het
Rhoj C T 12: 75,391,712 P91S probably damaging Het
Rnf10 A G 5: 115,249,998 F367S probably damaging Het
Rnft1 A T 11: 86,493,196 R307S probably benign Het
Ryr3 A T 2: 112,754,877 F2788Y probably damaging Het
Scgb1c1 A G 7: 140,846,224 K78E possibly damaging Het
Scn5a G T 9: 119,560,286 A123E probably damaging Het
Setd2 T A 9: 110,549,839 Y623* probably null Het
Tbl2 C T 5: 135,157,591 Q216* probably null Het
Thegl A G 5: 77,016,486 D112G possibly damaging Het
Tnc A G 4: 64,008,709 I860T probably damaging Het
Trafd1 T C 5: 121,373,303 K484R possibly damaging Het
Trank1 T C 9: 111,390,567 V2124A probably damaging Het
Trpm4 A T 7: 45,310,332 W713R probably damaging Het
Uap1l1 T C 2: 25,362,676 T451A probably benign Het
Uba6 A T 5: 86,131,260 C668S probably damaging Het
Ubxn11 T C 4: 134,126,624 F441S probably damaging Het
Vmn1r22 C T 6: 57,900,738 V85M probably damaging Het
Vmn2r72 T A 7: 85,751,942 I90L probably damaging Het
Wdr60 T C 12: 116,218,113 S769G probably damaging Het
Zfp330 T C 8: 82,764,956 E196G probably benign Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp994 T C 17: 22,201,713 E85G possibly damaging Het
Other mutations in Mical1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Mical1 APN 10 41479069 critical splice donor site probably null
IGL01594:Mical1 APN 10 41480329 missense probably damaging 1.00
IGL02065:Mical1 APN 10 41484411 missense possibly damaging 0.55
IGL02321:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02323:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02324:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02327:Mical1 APN 10 41486664 missense possibly damaging 0.52
IGL02416:Mical1 APN 10 41484810 critical splice donor site probably null
IGL02419:Mical1 APN 10 41482277 missense possibly damaging 0.73
IGL03027:Mical1 APN 10 41479505 unclassified probably benign
IGL03087:Mical1 APN 10 41482690 missense probably damaging 1.00
IGL03368:Mical1 APN 10 41479629 missense probably damaging 0.96
IGL03387:Mical1 APN 10 41478199 missense probably damaging 1.00
PIT1430001:Mical1 UTSW 10 41483496 missense possibly damaging 0.55
R0433:Mical1 UTSW 10 41479490 missense probably benign 0.15
R0617:Mical1 UTSW 10 41481315 missense probably damaging 0.97
R0638:Mical1 UTSW 10 41482239 missense probably benign 0.01
R1535:Mical1 UTSW 10 41485211 missense possibly damaging 0.55
R1623:Mical1 UTSW 10 41481393 critical splice donor site probably null
R1712:Mical1 UTSW 10 41480363 missense probably damaging 1.00
R1806:Mical1 UTSW 10 41478214 missense probably damaging 0.96
R1835:Mical1 UTSW 10 41483535 missense probably benign 0.00
R1866:Mical1 UTSW 10 41485470 missense probably benign 0.39
R2134:Mical1 UTSW 10 41482712 missense probably damaging 1.00
R2352:Mical1 UTSW 10 41482233 missense probably benign 0.21
R3740:Mical1 UTSW 10 41479071 missense probably benign 0.01
R4033:Mical1 UTSW 10 41481176 missense probably benign 0.40
R4093:Mical1 UTSW 10 41486937 unclassified probably benign
R4184:Mical1 UTSW 10 41481870 unclassified probably benign
R4194:Mical1 UTSW 10 41481628 missense possibly damaging 0.88
R4659:Mical1 UTSW 10 41486936 unclassified probably benign
R5139:Mical1 UTSW 10 41478415 splice site probably null
R5173:Mical1 UTSW 10 41484989 missense probably damaging 1.00
R5340:Mical1 UTSW 10 41483431 splice site probably null
R5501:Mical1 UTSW 10 41486079 missense probably benign 0.01
R5726:Mical1 UTSW 10 41483696 unclassified probably benign
R5864:Mical1 UTSW 10 41486068 missense possibly damaging 0.88
R5905:Mical1 UTSW 10 41486877 missense probably benign 0.00
R6028:Mical1 UTSW 10 41486877 missense probably benign 0.00
R6047:Mical1 UTSW 10 41481707 critical splice donor site probably null
R6074:Mical1 UTSW 10 41486065 missense probably benign 0.27
R6458:Mical1 UTSW 10 41484735 missense probably benign 0.44
R6879:Mical1 UTSW 10 41484519 missense probably damaging 0.99
R6966:Mical1 UTSW 10 41479754 missense probably damaging 0.98
R7049:Mical1 UTSW 10 41482250 missense possibly damaging 0.63
R7095:Mical1 UTSW 10 41479210 splice site probably null
R7156:Mical1 UTSW 10 41485257 critical splice donor site probably null
R7312:Mical1 UTSW 10 41479776 critical splice donor site probably null
R8021:Mical1 UTSW 10 41482724 missense probably damaging 0.97
R8056:Mical1 UTSW 10 41481172 missense probably damaging 1.00
R8427:Mical1 UTSW 10 41478595 missense probably damaging 1.00
R8883:Mical1 UTSW 10 41479640 missense
R9021:Mical1 UTSW 10 41485145 missense probably benign 0.43
R9368:Mical1 UTSW 10 41481306 missense possibly damaging 0.76
R9526:Mical1 UTSW 10 41482606 missense probably benign
X0020:Mical1 UTSW 10 41478996 missense probably damaging 1.00
Z1177:Mical1 UTSW 10 41481705 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTGTAAAACGGACAGTGG -3'
(R):5'- CACTGTCAGGAAGGAGTCAG -3'

Sequencing Primer
(F):5'- ACGGACAGTGGTTTTTCTTATCCAAG -3'
(R):5'- CTGTCAGGAAGGAGTCAGCTGAC -3'
Posted On 2017-12-01