Incidental Mutation 'R5601:Ccdc13'
ID439027
Institutional Source Beutler Lab
Gene Symbol Ccdc13
Ensembl Gene ENSMUSG00000079235
Gene Namecoiled-coil domain containing 13
Synonyms
MMRRC Submission 043153-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5601 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location121797627-121839461 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 121800572 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 114 (Q114*)
Ref Sequence ENSEMBL: ENSMUSP00000130887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135986] [ENSMUST00000142783] [ENSMUST00000155511]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126851
Predicted Effect probably null
Transcript: ENSMUST00000135986
AA Change: Q596*
SMART Domains Protein: ENSMUSP00000114787
Gene: ENSMUSG00000079235
AA Change: Q596*

DomainStartEndE-ValueType
coiled coil region 19 46 N/A INTRINSIC
coiled coil region 70 103 N/A INTRINSIC
coiled coil region 139 178 N/A INTRINSIC
coiled coil region 206 248 N/A INTRINSIC
low complexity region 293 304 N/A INTRINSIC
coiled coil region 323 370 N/A INTRINSIC
coiled coil region 428 458 N/A INTRINSIC
coiled coil region 550 604 N/A INTRINSIC
coiled coil region 648 670 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140929
Predicted Effect probably null
Transcript: ENSMUST00000142783
AA Change: Q114*
SMART Domains Protein: ENSMUSP00000130887
Gene: ENSMUSG00000079235
AA Change: Q114*

DomainStartEndE-ValueType
coiled coil region 68 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155511
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 G A 13: 91,782,910 V426I probably benign Het
Asmt T C X: 170,676,392 V212A probably damaging Het
Atn1 A G 6: 124,743,228 probably null Het
Auts2 G T 5: 131,476,823 probably benign Het
AW551984 C T 9: 39,591,267 V672M possibly damaging Het
Ces2e A T 8: 104,929,494 I146F probably benign Het
Cfap44 A G 16: 44,460,186 K1443E probably damaging Het
Cma2 T A 14: 55,973,789 H179Q possibly damaging Het
Cpsf2 G T 12: 101,985,355 probably null Het
Cwh43 A G 5: 73,417,940 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dram1 A G 10: 88,324,767 S231P probably damaging Het
Fbxw7 A G 3: 84,976,208 D482G probably damaging Het
Fstl1 T C 16: 37,826,799 I177T probably benign Het
Fut9 T C 4: 25,620,299 T172A probably benign Het
Gm10436 T C 12: 88,176,047 D267G probably damaging Het
Gm5134 G A 10: 75,985,952 V207M probably damaging Het
Hccs G A X: 169,313,601 R203C probably damaging Het
Hmgxb3 A T 18: 61,137,622 F877I probably damaging Het
Ide A G 19: 37,314,980 V272A unknown Het
Impact C T 18: 12,976,007 T65I probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Muc3 A G 5: 137,138,015 S309P probably damaging Het
Myf6 A C 10: 107,494,614 S31A probably damaging Het
Olfr733 C A 14: 50,298,861 W149C probably damaging Het
Olfr881 C G 9: 37,992,714 T74R possibly damaging Het
P4hb T A 11: 120,571,615 E88D possibly damaging Het
Pcdhb9 T C 18: 37,402,206 C418R probably damaging Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Prss58 A T 6: 40,897,849 N19K possibly damaging Het
Ptprq C T 10: 107,608,430 A1438T probably benign Het
Rfx4 A T 10: 84,798,578 T61S probably damaging Het
Sclt1 T A 3: 41,730,919 N35Y probably benign Het
Sec24b CTG CTGGTG 3: 130,040,834 probably benign Het
Serpinb12 T C 1: 106,953,697 I188T probably damaging Het
Slc27a4 A T 2: 29,805,660 Y69F probably benign Het
Slc3a1 T C 17: 85,032,891 V247A probably benign Het
Slc4a2 C T 5: 24,438,774 T854I probably benign Het
Stat5b G A 11: 100,783,175 T761M probably damaging Het
Stkld1 T C 2: 26,952,705 L563P probably damaging Het
Tbc1d23 C A 16: 57,198,309 C283F probably benign Het
Tcaf3 T C 6: 42,587,528 N900S possibly damaging Het
Tkfc T C 19: 10,594,563 T370A probably benign Het
Tpr T C 1: 150,435,853 V1868A possibly damaging Het
Triobp T A 15: 78,973,633 W1145R probably damaging Het
Uhrf1bp1 C A 17: 27,884,494 A392D probably damaging Het
Vmn2r82 T G 10: 79,396,191 L675V probably damaging Het
Zfp423 T C 8: 87,782,009 E444G probably damaging Het
Other mutations in Ccdc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Ccdc13 APN 9 121810084 splice site probably benign
IGL01306:Ccdc13 APN 9 121827363 missense probably benign 0.37
ANU23:Ccdc13 UTSW 9 121827363 missense probably benign 0.37
R0112:Ccdc13 UTSW 9 121813481 missense probably damaging 0.98
R0144:Ccdc13 UTSW 9 121827351 missense probably damaging 0.98
R0360:Ccdc13 UTSW 9 121798216 missense probably damaging 1.00
R0364:Ccdc13 UTSW 9 121798216 missense probably damaging 1.00
R1441:Ccdc13 UTSW 9 121813449 missense probably benign 0.44
R1674:Ccdc13 UTSW 9 121809142 missense probably damaging 1.00
R1691:Ccdc13 UTSW 9 121825068 splice site probably null
R1710:Ccdc13 UTSW 9 121819581 missense probably damaging 1.00
R3821:Ccdc13 UTSW 9 121831019 missense probably damaging 1.00
R3822:Ccdc13 UTSW 9 121831019 missense probably damaging 1.00
R3962:Ccdc13 UTSW 9 121798939 intron probably benign
R4695:Ccdc13 UTSW 9 121820760 missense probably damaging 1.00
R4758:Ccdc13 UTSW 9 121833734 missense possibly damaging 0.91
R5058:Ccdc13 UTSW 9 121817547 intron probably benign
R5283:Ccdc13 UTSW 9 121808188 missense probably damaging 1.00
R5436:Ccdc13 UTSW 9 121799043 missense probably benign 0.06
R5623:Ccdc13 UTSW 9 121833733 missense probably damaging 0.99
R5653:Ccdc13 UTSW 9 121798787 makesense probably null
R5665:Ccdc13 UTSW 9 121814290 missense probably damaging 0.99
R5975:Ccdc13 UTSW 9 121827235 missense probably benign 0.00
R6212:Ccdc13 UTSW 9 121798909 intron probably benign
R6213:Ccdc13 UTSW 9 121798909 intron probably benign
R6214:Ccdc13 UTSW 9 121798909 intron probably benign
R6215:Ccdc13 UTSW 9 121798909 intron probably benign
R6222:Ccdc13 UTSW 9 121798909 intron probably benign
R6223:Ccdc13 UTSW 9 121798909 intron probably benign
R6257:Ccdc13 UTSW 9 121798909 intron probably benign
R7053:Ccdc13 UTSW 9 121833838 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGATGACACCTTTTGGGACC -3'
(R):5'- GCTACCACCTCCATAGTGTGTC -3'

Sequencing Primer
(F):5'- ACATGGGGCAAGAAGTCCTCC -3'
(R):5'- CCATAGTGTGTCTACCACTGTGG -3'
Posted On2016-10-26