Incidental Mutation 'R5656:Cd68'
ID442343
Institutional Source Beutler Lab
Gene Symbol Cd68
Ensembl Gene ENSMUSG00000018774
Gene NameCD68 antigen
SynonymsLamp4, gp110, Scard1, macrosialin
MMRRC Submission 043302-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R5656 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69664213-69666153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69664421 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 320 (I320F)
Ref Sequence ENSEMBL: ENSMUSP00000104294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018905] [ENSMUST00000018918] [ENSMUST00000102589] [ENSMUST00000108654] [ENSMUST00000163666] [ENSMUST00000155200] [ENSMUST00000148242]
Predicted Effect probably benign
Transcript: ENSMUST00000018905
SMART Domains Protein: ENSMUSP00000018905
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
CTNS 56 87 1.69e-6 SMART
low complexity region 141 157 N/A INTRINSIC
CTNS 167 198 5.56e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000018918
AA Change: I311F

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000018918
Gene: ENSMUSG00000018774
AA Change: I311F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Lamp 28 326 5.6e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083928
Predicted Effect probably benign
Transcript: ENSMUST00000102589
Predicted Effect probably damaging
Transcript: ENSMUST00000108654
AA Change: I320F

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104294
Gene: ENSMUSG00000018774
AA Change: I320F

DomainStartEndE-ValueType
Pfam:Lamp 16 335 3.1e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123995
Predicted Effect probably benign
Transcript: ENSMUST00000125389
SMART Domains Protein: ENSMUSP00000129025
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
CTNS 39 70 1.69e-6 SMART
low complexity region 89 104 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128519
Predicted Effect probably benign
Transcript: ENSMUST00000129224
SMART Domains Protein: ENSMUSP00000120001
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
CTNS 54 85 1.69e-6 SMART
low complexity region 138 163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140186
Predicted Effect probably benign
Transcript: ENSMUST00000163666
SMART Domains Protein: ENSMUSP00000127034
Gene: ENSMUSG00000059796

DomainStartEndE-ValueType
DEXDc 51 249 3.61e-60 SMART
HELICc 286 367 1.04e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155200
SMART Domains Protein: ENSMUSP00000117715
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
CTNS 56 87 1.69e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148242
SMART Domains Protein: ENSMUSP00000133074
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
CTNS 56 87 1.69e-6 SMART
low complexity region 98 109 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 110-kD transmembrane glycoprotein that is highly expressed by human monocytes and tissue macrophages. It is a member of the lysosomal/endosomal-associated membrane glycoprotein (LAMP) family. The protein primarily localizes to lysosomes and endosomes with a smaller fraction circulating to the cell surface. It is a type I integral membrane protein with a heavily glycosylated extracellular domain and binds to tissue- and organ-specific lectins or selectins. The protein is also a member of the scavenger receptor family. Scavenger receptors typically function to clear cellular debris, promote phagocytosis, and mediate the recruitment and activation of macrophages. Alternative splicing results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced antigen presenting activity in dendritic cells in response to ovalbumin stimulation. Mice homozygous for another knock-out allele exhibit increased bone and dysfunctional osteoclasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Adrb3 T C 8: 27,227,377 D348G probably damaging Het
Atg2b A G 12: 105,621,328 V1959A probably benign Het
Bicral G A 17: 46,808,369 T742M probably damaging Het
Bub1b T A 2: 118,605,431 I60N probably damaging Het
Ccdc162 A G 10: 41,569,934 V414A probably benign Het
Cd22 T G 7: 30,869,773 Y612S probably damaging Het
Clca3a2 A T 3: 144,797,632 N852K probably benign Het
Cpa6 T A 1: 10,329,514 H363L probably benign Het
Ddx18 A T 1: 121,561,358 L320Q probably damaging Het
Dnah5 A G 15: 28,421,064 D3849G probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Efs T C 14: 54,917,127 T552A probably damaging Het
Fbp1 C A 13: 62,875,196 V96L probably damaging Het
Gtf3c1 T A 7: 125,662,654 N1139I probably benign Het
Gucy1b2 T C 14: 62,422,981 Y152C probably damaging Het
Gxylt1 A T 15: 93,245,661 L362Q probably damaging Het
Iqcd A G 5: 120,605,126 probably null Het
Klhl41 T A 2: 69,683,532 I585N possibly damaging Het
Map6 A G 7: 99,336,298 K470E probably damaging Het
Mast3 T C 8: 70,786,221 T496A probably damaging Het
Mbd6 A T 10: 127,285,286 probably benign Het
Melk A G 4: 44,312,237 K183R possibly damaging Het
Mta1 T C 12: 113,123,139 V152A probably damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Nav3 A C 10: 109,764,633 S1378A probably damaging Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Nlrp4f G A 13: 65,190,871 R651* probably null Het
Olfr1480 A G 19: 13,530,380 T280A probably benign Het
Olfr397 T A 11: 73,964,710 M34K probably damaging Het
Olfr497 A G 7: 108,422,618 I16V probably benign Het
P2rx7 A T 5: 122,673,717 R364W probably damaging Het
Phactr2 T C 10: 13,388,703 D2G probably benign Het
Phc3 G T 3: 30,965,866 S28R probably damaging Het
Ppfia1 A T 7: 144,519,974 probably null Het
Prdm10 C T 9: 31,353,417 T667M probably benign Het
Pwwp2b T A 7: 139,255,971 S443T possibly damaging Het
Pzp T C 6: 128,490,072 T1113A probably damaging Het
Rapgef6 A G 11: 54,636,136 E551G possibly damaging Het
Sec23ip A G 7: 128,776,784 Y774C probably damaging Het
Setdb2 T C 14: 59,419,118 D266G probably damaging Het
Shank1 T C 7: 44,352,886 V1343A probably benign Het
Slf2 T A 19: 44,973,235 D1064E probably benign Het
Slu7 A G 11: 43,443,418 K424E probably benign Het
Smg1 A T 7: 118,154,664 probably benign Het
Sptlc2 A T 12: 87,346,761 L264Q probably damaging Het
Sra1 A G 18: 36,678,407 S93P probably damaging Het
Sult1c1 T C 17: 53,964,652 E169G probably benign Het
Sv2a A G 3: 96,185,572 D196G probably damaging Het
Tbc1d22b A G 17: 29,594,780 I362M probably damaging Het
Tenm3 T C 8: 48,228,762 D2611G probably damaging Het
Tmem43 T C 6: 91,480,708 F191L probably benign Het
Trbv13-2 T A 6: 41,121,694 Y68N probably benign Het
Ttn T G 2: 76,774,654 D18312A possibly damaging Het
Ublcp1 A G 11: 44,465,606 V95A probably damaging Het
Usp17ld A G 7: 103,250,840 V295A probably damaging Het
Vmn1r29 T A 6: 58,308,167 L291M possibly damaging Het
Vsig10l C T 7: 43,464,151 R176* probably null Het
Zbtb46 A G 2: 181,423,417 probably null Het
Zfp644 A G 5: 106,637,982 V233A probably benign Het
Other mutations in Cd68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Cd68 APN 11 69665850 missense probably damaging 1.00
IGL01918:Cd68 APN 11 69665101 missense possibly damaging 0.91
R1474:Cd68 UTSW 11 69664928 unclassified probably benign
R1556:Cd68 UTSW 11 69665850 missense probably damaging 1.00
R5014:Cd68 UTSW 11 69665339 missense probably damaging 1.00
R5397:Cd68 UTSW 11 69665658 missense probably benign 0.00
R7425:Cd68 UTSW 11 69665112 missense probably benign 0.30
R7442:Cd68 UTSW 11 69665928 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGAGTAGTAGGTACCATTCATG -3'
(R):5'- TGCTCTCACCTATGGGTTGG -3'

Sequencing Primer
(F):5'- GGTACCATTCATGTTTATTGATTCCC -3'
(R):5'- ACCTATGGGTTGGCTCCTCAG -3'
Posted On2016-11-09