Incidental Mutation 'R5656:Nlrp4f'
ID442349
Institutional Source Beutler Lab
Gene Symbol Nlrp4f
Ensembl Gene ENSMUSG00000032999
Gene NameNLR family, pyrin domain containing 4F
SynonymsNalp-kappa, Nalp4f, C330026N02Rik
MMRRC Submission 043302-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5656 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location65177111-65205977 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 65190871 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 651 (R651*)
Ref Sequence ENSEMBL: ENSMUSP00000152418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037372] [ENSMUST00000220448] [ENSMUST00000221659] [ENSMUST00000222514] [ENSMUST00000222559] [ENSMUST00000223418]
Predicted Effect probably null
Transcript: ENSMUST00000037372
AA Change: R651*
SMART Domains Protein: ENSMUSP00000041908
Gene: ENSMUSG00000032999
AA Change: R651*

DomainStartEndE-ValueType
PYRIN 6 88 1.44e-26 SMART
Pfam:NACHT 147 316 3.4e-39 PFAM
LRR 632 659 1.18e1 SMART
LRR 686 713 4.22e1 SMART
LRR 715 742 5.66e1 SMART
LRR 743 769 4.03e0 SMART
LRR 771 798 1.17e0 SMART
LRR 799 826 1.43e-1 SMART
LRR 828 855 1.03e-2 SMART
LRR 856 883 5.59e-4 SMART
LRR 885 912 2.91e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220448
Predicted Effect probably null
Transcript: ENSMUST00000221659
AA Change: R651*
Predicted Effect probably null
Transcript: ENSMUST00000222514
AA Change: R651*
Predicted Effect probably benign
Transcript: ENSMUST00000222559
Predicted Effect probably benign
Transcript: ENSMUST00000223418
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Adrb3 T C 8: 27,227,377 D348G probably damaging Het
Atg2b A G 12: 105,621,328 V1959A probably benign Het
Bicral G A 17: 46,808,369 T742M probably damaging Het
Bub1b T A 2: 118,605,431 I60N probably damaging Het
Ccdc162 A G 10: 41,569,934 V414A probably benign Het
Cd22 T G 7: 30,869,773 Y612S probably damaging Het
Cd68 T A 11: 69,664,421 I320F probably damaging Het
Clca3a2 A T 3: 144,797,632 N852K probably benign Het
Cpa6 T A 1: 10,329,514 H363L probably benign Het
Ddx18 A T 1: 121,561,358 L320Q probably damaging Het
Dnah5 A G 15: 28,421,064 D3849G probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Efs T C 14: 54,917,127 T552A probably damaging Het
Fbp1 C A 13: 62,875,196 V96L probably damaging Het
Gtf3c1 T A 7: 125,662,654 N1139I probably benign Het
Gucy1b2 T C 14: 62,422,981 Y152C probably damaging Het
Gxylt1 A T 15: 93,245,661 L362Q probably damaging Het
Iqcd A G 5: 120,605,126 probably null Het
Klhl41 T A 2: 69,683,532 I585N possibly damaging Het
Map6 A G 7: 99,336,298 K470E probably damaging Het
Mast3 T C 8: 70,786,221 T496A probably damaging Het
Mbd6 A T 10: 127,285,286 probably benign Het
Melk A G 4: 44,312,237 K183R possibly damaging Het
Mta1 T C 12: 113,123,139 V152A probably damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Nav3 A C 10: 109,764,633 S1378A probably damaging Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1480 A G 19: 13,530,380 T280A probably benign Het
Olfr397 T A 11: 73,964,710 M34K probably damaging Het
Olfr497 A G 7: 108,422,618 I16V probably benign Het
P2rx7 A T 5: 122,673,717 R364W probably damaging Het
Phactr2 T C 10: 13,388,703 D2G probably benign Het
Phc3 G T 3: 30,965,866 S28R probably damaging Het
Ppfia1 A T 7: 144,519,974 probably null Het
Prdm10 C T 9: 31,353,417 T667M probably benign Het
Pwwp2b T A 7: 139,255,971 S443T possibly damaging Het
Pzp T C 6: 128,490,072 T1113A probably damaging Het
Rapgef6 A G 11: 54,636,136 E551G possibly damaging Het
Sec23ip A G 7: 128,776,784 Y774C probably damaging Het
Setdb2 T C 14: 59,419,118 D266G probably damaging Het
Shank1 T C 7: 44,352,886 V1343A probably benign Het
Slf2 T A 19: 44,973,235 D1064E probably benign Het
Slu7 A G 11: 43,443,418 K424E probably benign Het
Smg1 A T 7: 118,154,664 probably benign Het
Sptlc2 A T 12: 87,346,761 L264Q probably damaging Het
Sra1 A G 18: 36,678,407 S93P probably damaging Het
Sult1c1 T C 17: 53,964,652 E169G probably benign Het
Sv2a A G 3: 96,185,572 D196G probably damaging Het
Tbc1d22b A G 17: 29,594,780 I362M probably damaging Het
Tenm3 T C 8: 48,228,762 D2611G probably damaging Het
Tmem43 T C 6: 91,480,708 F191L probably benign Het
Trbv13-2 T A 6: 41,121,694 Y68N probably benign Het
Ttn T G 2: 76,774,654 D18312A possibly damaging Het
Ublcp1 A G 11: 44,465,606 V95A probably damaging Het
Usp17ld A G 7: 103,250,840 V295A probably damaging Het
Vmn1r29 T A 6: 58,308,167 L291M possibly damaging Het
Vsig10l C T 7: 43,464,151 R176* probably null Het
Zbtb46 A G 2: 181,423,417 probably null Het
Zfp644 A G 5: 106,637,982 V233A probably benign Het
Other mutations in Nlrp4f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Nlrp4f APN 13 65195543 nonsense probably null
IGL01676:Nlrp4f APN 13 65195119 missense possibly damaging 0.95
IGL01701:Nlrp4f APN 13 65199409 missense probably damaging 1.00
IGL01799:Nlrp4f APN 13 65187462 missense probably benign 0.03
IGL02084:Nlrp4f APN 13 65194171 nonsense probably null
IGL02234:Nlrp4f APN 13 65194488 missense probably damaging 1.00
IGL02481:Nlrp4f APN 13 65194734 missense probably benign 0.04
IGL02483:Nlrp4f APN 13 65194734 missense probably benign 0.04
IGL02625:Nlrp4f APN 13 65199271 missense probably damaging 1.00
IGL02814:Nlrp4f APN 13 65185042 missense probably damaging 0.98
IGL03077:Nlrp4f APN 13 65194598 missense probably benign 0.10
IGL03111:Nlrp4f APN 13 65183002 missense probably damaging 1.00
IGL03175:Nlrp4f APN 13 65194596 missense probably damaging 1.00
IGL03324:Nlrp4f APN 13 65195228 missense possibly damaging 0.91
R0398:Nlrp4f UTSW 13 65194918 missense possibly damaging 0.79
R0477:Nlrp4f UTSW 13 65190906 missense probably benign 0.01
R0707:Nlrp4f UTSW 13 65194503 missense probably benign 0.42
R1052:Nlrp4f UTSW 13 65185083 missense possibly damaging 0.73
R1302:Nlrp4f UTSW 13 65194557 missense possibly damaging 0.77
R1460:Nlrp4f UTSW 13 65190268 missense probably benign 0.23
R1970:Nlrp4f UTSW 13 65194091 missense probably damaging 1.00
R2111:Nlrp4f UTSW 13 65199353 missense probably benign 0.11
R2272:Nlrp4f UTSW 13 65194408 missense probably benign 0.01
R2370:Nlrp4f UTSW 13 65190846 missense probably damaging 0.99
R2680:Nlrp4f UTSW 13 65194343 nonsense probably null
R3120:Nlrp4f UTSW 13 65194716 missense probably benign 0.13
R3737:Nlrp4f UTSW 13 65194007 missense probably benign 0.01
R4035:Nlrp4f UTSW 13 65194007 missense probably benign 0.01
R4107:Nlrp4f UTSW 13 65183065 missense probably benign 0.01
R4422:Nlrp4f UTSW 13 65184962 critical splice donor site probably null
R4718:Nlrp4f UTSW 13 65194989 missense probably benign 0.01
R5652:Nlrp4f UTSW 13 65182989 missense probably benign 0.00
R5912:Nlrp4f UTSW 13 65194908 missense probably damaging 0.99
R5915:Nlrp4f UTSW 13 65187555 missense probably damaging 1.00
R5955:Nlrp4f UTSW 13 65195081 missense probably benign 0.15
R6683:Nlrp4f UTSW 13 65199195 missense probably benign 0.01
R6742:Nlrp4f UTSW 13 65187440 critical splice donor site probably null
R6750:Nlrp4f UTSW 13 65181654 nonsense probably null
R6751:Nlrp4f UTSW 13 65194429 missense probably damaging 0.99
R7110:Nlrp4f UTSW 13 65199346 missense probably damaging 0.96
R7143:Nlrp4f UTSW 13 65195306 missense probably damaging 1.00
R7143:Nlrp4f UTSW 13 65199352 missense possibly damaging 0.90
R7187:Nlrp4f UTSW 13 65195387 missense possibly damaging 0.47
R7230:Nlrp4f UTSW 13 65194901 missense probably benign 0.16
R7283:Nlrp4f UTSW 13 65195538 nonsense probably null
R7501:Nlrp4f UTSW 13 65194329 missense probably damaging 0.99
R7863:Nlrp4f UTSW 13 65194245 missense possibly damaging 0.63
R7889:Nlrp4f UTSW 13 65195018 missense probably damaging 1.00
Z1088:Nlrp4f UTSW 13 65194302 missense probably benign 0.00
Z1177:Nlrp4f UTSW 13 65194661 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCAAGACAGAAAGATTCCAC -3'
(R):5'- AGCTCCAGCAGGTTTTATCATCTG -3'

Sequencing Primer
(F):5'- GTCAAGACAGAAAGATTCCACTTTAG -3'
(R):5'- GATGTTTGTGAACCACCACG -3'
Posted On2016-11-09