Incidental Mutation 'R5678:Atr'
ID442891
Institutional Source Beutler Lab
Gene Symbol Atr
Ensembl Gene ENSMUSG00000032409
Gene Nameataxia telangiectasia and Rad3 related
Synonyms
MMRRC Submission 043317-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5678 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location95857597-95951781 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 95951487 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 2597 (Q2597*)
Ref Sequence ENSEMBL: ENSMUSP00000149953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034980] [ENSMUST00000034981] [ENSMUST00000185633] [ENSMUST00000189106] [ENSMUST00000190665] [ENSMUST00000215311]
Predicted Effect probably null
Transcript: ENSMUST00000034980
AA Change: Q2591*
SMART Domains Protein: ENSMUSP00000034980
Gene: ENSMUSG00000032409
AA Change: Q2591*

DomainStartEndE-ValueType
low complexity region 431 449 N/A INTRINSIC
low complexity region 889 897 N/A INTRINSIC
low complexity region 998 1013 N/A INTRINSIC
UME 1119 1225 2.3e-43 SMART
low complexity region 1352 1362 N/A INTRINSIC
Pfam:FAT 1771 2092 9.2e-51 PFAM
PI3Kc 2320 2630 7.51e-124 SMART
FATC 2609 2641 6.22e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034981
SMART Domains Protein: ENSMUSP00000034981
Gene: ENSMUSG00000032410

DomainStartEndE-ValueType
Pfam:XRN_N 1 227 8.4e-99 PFAM
low complexity region 372 389 N/A INTRINSIC
low complexity region 414 430 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 1054 1066 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1665 1684 N/A INTRINSIC
low complexity region 1696 1711 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185324
Predicted Effect probably benign
Transcript: ENSMUST00000185633
SMART Domains Protein: ENSMUSP00000140278
Gene: ENSMUSG00000032410

DomainStartEndE-ValueType
Pfam:XRN_N 1 228 1.2e-103 PFAM
low complexity region 372 389 N/A INTRINSIC
low complexity region 414 430 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 1054 1066 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1661 1680 N/A INTRINSIC
low complexity region 1692 1707 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188854
Predicted Effect probably benign
Transcript: ENSMUST00000189106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189612
Predicted Effect probably benign
Transcript: ENSMUST00000190665
SMART Domains Protein: ENSMUSP00000139510
Gene: ENSMUSG00000032410

DomainStartEndE-ValueType
Pfam:XRN_N 1 228 4.9e-104 PFAM
low complexity region 372 389 N/A INTRINSIC
low complexity region 414 430 N/A INTRINSIC
PDB:2Y35|A 654 939 2e-36 PDB
low complexity region 946 958 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000215311
AA Change: Q2597*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs the PI3/PI4-kinase family, and is most closely related to ATM, a protein kinase encoded by the gene mutated in ataxia telangiectasia. This protein and ATM share similarity with Schizosaccharomyces pombe rad3, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This kinase has been shown to phosphorylate checkpoint kinase CHK1, checkpoint proteins RAD17, and RAD9, as well as tumor suppressor protein BRCA1. Mutations of this gene are associated with Seckel syndrome. An alternatively spliced transcript variant of this gene has been reported, however, its full length nature is not known. Transcript variants utilizing alternative polyA sites exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for a knock-out allele exhibit premature death and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T C 11: 23,516,529 T168A probably damaging Het
3425401B19Rik T A 14: 32,662,053 R652W probably damaging Het
A530016L24Rik T G 12: 112,496,872 C43W probably damaging Het
Aatk T C 11: 120,010,154 T1082A probably benign Het
Acsl1 T A 8: 46,492,850 F7I probably benign Het
Adgb T G 10: 10,431,326 S299R possibly damaging Het
Apob T C 12: 7,991,494 F738L possibly damaging Het
Art3 T C 5: 92,392,550 Y51H probably damaging Het
Atrn T C 2: 130,970,016 V627A probably damaging Het
Baz1a T C 12: 54,900,532 K1111E probably damaging Het
Ccdc40 T C 11: 119,231,572 S67P possibly damaging Het
Cd164 T C 10: 41,519,952 probably null Het
Cep295 T C 9: 15,322,858 D2214G probably damaging Het
Clcn1 A G 6: 42,307,265 Y589C probably damaging Het
Col1a2 C T 6: 4,536,239 A998V unknown Het
Csrnp2 T C 15: 100,481,804 *535W probably null Het
Dhrs7 C T 12: 72,657,332 G130D probably damaging Het
Dnah3 T C 7: 120,077,851 T477A probably benign Het
Dscam A G 16: 96,790,900 F725S probably benign Het
Dstyk T C 1: 132,453,291 V508A probably benign Het
Eif4g3 A G 4: 138,151,742 E595G probably damaging Het
Epha6 A T 16: 59,818,979 V844E probably damaging Het
Esrp2 G A 8: 106,132,118 A629V probably damaging Het
Fam208a CGCGGCGGCGGCGGCGG CGCGGCGGCGGCGGCGGCGGCGG 14: 27,429,123 probably benign Het
Fndc3b A G 3: 27,429,023 S1009P probably benign Het
Gm13762 A T 2: 88,972,973 L306* probably null Het
Gm14124 A T 2: 150,268,505 R372* probably null Het
Gm8257 A T 14: 44,657,249 I28N probably damaging Het
Ighv5-9-1 T C 12: 113,736,587 E4G possibly damaging Het
Ints3 A G 3: 90,403,548 V455A probably damaging Het
Lamtor2 A G 3: 88,550,794 probably benign Het
Npy1r T C 8: 66,704,203 C92R probably damaging Het
Nup210l T C 3: 90,190,959 V1406A probably damaging Het
Olfr1248 A G 2: 89,617,281 F304L probably benign Het
Olfr978 T C 9: 39,993,903 V31A probably benign Het
Pqlc1 T C 18: 80,257,034 I40T probably damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Qdpr T C 5: 45,447,637 E43G possibly damaging Het
Rps6ka5 T C 12: 100,724,876 E2G unknown Het
Setd2 A G 9: 110,602,186 T5A probably damaging Het
Srpk2 TCA T 5: 23,524,606 probably null Het
Sympk T C 7: 19,049,472 probably null Het
Tchh A T 3: 93,445,626 Q791L unknown Het
Tmed11 T C 5: 108,786,165 D55G probably benign Het
Tnrc18 T C 5: 142,733,564 D1989G unknown Het
Utp20 A T 10: 88,809,117 H582Q probably benign Het
Utrn A G 10: 12,442,018 I554T probably damaging Het
Zfp119a T C 17: 55,868,336 E53G probably benign Het
Other mutations in Atr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Atr APN 9 95865052 missense probably damaging 1.00
IGL00922:Atr APN 9 95907345 missense probably damaging 0.97
IGL01020:Atr APN 9 95862783 missense probably damaging 1.00
IGL01345:Atr APN 9 95940949 missense probably damaging 1.00
IGL01364:Atr APN 9 95865624 missense probably benign 0.29
IGL01456:Atr APN 9 95950565 missense possibly damaging 0.62
IGL01534:Atr APN 9 95865546 missense probably damaging 0.99
IGL01761:Atr APN 9 95951448 splice site probably benign
IGL01791:Atr APN 9 95921781 missense probably benign 0.05
IGL01831:Atr APN 9 95870754 missense probably benign 0.18
IGL01973:Atr APN 9 95871674 missense probably damaging 1.00
IGL02008:Atr APN 9 95881420 splice site probably benign
IGL02016:Atr APN 9 95927175 missense probably benign 0.09
IGL02035:Atr APN 9 95866682 missense probably benign 0.01
IGL02058:Atr APN 9 95871487 missense probably damaging 0.99
IGL02081:Atr APN 9 95883205 missense probably damaging 1.00
IGL02224:Atr APN 9 95878629 missense probably damaging 0.98
IGL02234:Atr APN 9 95947250 splice site probably benign
IGL02367:Atr APN 9 95899141 nonsense probably null
IGL02621:Atr APN 9 95908400 missense probably benign 0.00
IGL02728:Atr APN 9 95936475 missense probably damaging 1.00
IGL02833:Atr APN 9 95862852 missense probably damaging 1.00
IGL02939:Atr APN 9 95865261 missense probably benign
IGL03107:Atr APN 9 95897730 missense probably benign 0.28
IGL03382:Atr APN 9 95920822 nonsense probably null
PIT4812001:Atr UTSW 9 95910649 missense probably benign 0.41
R0042:Atr UTSW 9 95927356 splice site probably benign
R0042:Atr UTSW 9 95927356 splice site probably benign
R0281:Atr UTSW 9 95937566 missense probably benign 0.26
R0282:Atr UTSW 9 95862798 missense probably benign 0.12
R0512:Atr UTSW 9 95935526 missense probably damaging 0.99
R0547:Atr UTSW 9 95899165 splice site probably benign
R0567:Atr UTSW 9 95865829 missense probably benign 0.00
R0631:Atr UTSW 9 95874777 missense possibly damaging 0.92
R1116:Atr UTSW 9 95867636 nonsense probably null
R1171:Atr UTSW 9 95907323 missense probably damaging 1.00
R1241:Atr UTSW 9 95950636 missense probably benign 0.08
R1345:Atr UTSW 9 95920355 missense probably benign 0.25
R1400:Atr UTSW 9 95862848 missense probably benign 0.32
R1413:Atr UTSW 9 95932442 missense probably damaging 1.00
R1527:Atr UTSW 9 95870043 missense possibly damaging 0.82
R1557:Atr UTSW 9 95871449 missense probably damaging 1.00
R1591:Atr UTSW 9 95945385 missense probably damaging 1.00
R1602:Atr UTSW 9 95951557 missense probably damaging 1.00
R1605:Atr UTSW 9 95936463 missense probably damaging 1.00
R1670:Atr UTSW 9 95861456 missense probably benign 0.38
R1709:Atr UTSW 9 95871076 missense probably benign 0.00
R1728:Atr UTSW 9 95897581 missense probably benign 0.01
R1729:Atr UTSW 9 95897581 missense probably benign 0.01
R1739:Atr UTSW 9 95897581 missense probably benign 0.01
R1816:Atr UTSW 9 95866694 missense probably benign 0.00
R1824:Atr UTSW 9 95936421 missense probably damaging 1.00
R1844:Atr UTSW 9 95905817 missense probably benign 0.01
R1857:Atr UTSW 9 95865097 missense probably damaging 1.00
R1858:Atr UTSW 9 95865097 missense probably damaging 1.00
R1866:Atr UTSW 9 95870605 splice site probably null
R1913:Atr UTSW 9 95866733 missense probably benign 0.01
R2042:Atr UTSW 9 95870022 missense probably benign 0.00
R2210:Atr UTSW 9 95907300 missense probably damaging 1.00
R2230:Atr UTSW 9 95920765 missense probably damaging 1.00
R2361:Atr UTSW 9 95871157 missense probably benign 0.41
R2399:Atr UTSW 9 95871599 missense probably benign 0.00
R2431:Atr UTSW 9 95862892 missense probably benign 0.24
R2860:Atr UTSW 9 95874243 missense probably benign 0.07
R2861:Atr UTSW 9 95874243 missense probably benign 0.07
R3019:Atr UTSW 9 95905818 missense possibly damaging 0.52
R3684:Atr UTSW 9 95920400 missense probably damaging 0.96
R4155:Atr UTSW 9 95888124 nonsense probably null
R4295:Atr UTSW 9 95874426 missense probably benign 0.04
R4359:Atr UTSW 9 95951536 missense probably damaging 1.00
R4506:Atr UTSW 9 95865237 missense probably benign 0.21
R4523:Atr UTSW 9 95862863 missense probably damaging 1.00
R4536:Atr UTSW 9 95874418 missense probably benign 0.26
R4588:Atr UTSW 9 95865667 missense probably benign
R4646:Atr UTSW 9 95871197 critical splice donor site probably null
R4702:Atr UTSW 9 95920355 missense possibly damaging 0.92
R4743:Atr UTSW 9 95862792 missense probably benign 0.14
R4782:Atr UTSW 9 95862797 missense probably benign 0.00
R4928:Atr UTSW 9 95907299 missense probably damaging 1.00
R5031:Atr UTSW 9 95865702 missense probably damaging 0.98
R5138:Atr UTSW 9 95937596 missense probably benign 0.15
R5188:Atr UTSW 9 95921725 missense probably benign 0.00
R5219:Atr UTSW 9 95881238 missense probably damaging 0.99
R5307:Atr UTSW 9 95878544 missense probably benign 0.01
R5414:Atr UTSW 9 95870704 missense probably benign 0.00
R5628:Atr UTSW 9 95874226 nonsense probably null
R5664:Atr UTSW 9 95905813 missense probably benign 0.00
R5724:Atr UTSW 9 95866588 missense probably damaging 1.00
R5759:Atr UTSW 9 95874402 missense probably benign 0.01
R5763:Atr UTSW 9 95945123 missense probably benign 0.04
R5922:Atr UTSW 9 95903682 missense probably benign 0.00
R6051:Atr UTSW 9 95908369 missense possibly damaging 0.85
R6161:Atr UTSW 9 95865319 missense probably benign
R6171:Atr UTSW 9 95881271 nonsense probably null
R6532:Atr UTSW 9 95908408 missense probably benign
R6774:Atr UTSW 9 95927213 missense probably benign 0.00
R6894:Atr UTSW 9 95927197 missense probably damaging 1.00
R6930:Atr UTSW 9 95866635 missense probably benign 0.21
R7018:Atr UTSW 9 95866694 missense probably benign 0.17
R7056:Atr UTSW 9 95862863 missense probably damaging 1.00
R7103:Atr UTSW 9 95865372 missense probably damaging 0.98
R7154:Atr UTSW 9 95865045 missense probably benign
R7157:Atr UTSW 9 95869900 missense probably benign 0.00
R7188:Atr UTSW 9 95862791 nonsense probably null
R7189:Atr UTSW 9 95862791 nonsense probably null
R7300:Atr UTSW 9 95865370 missense probably benign 0.00
R7337:Atr UTSW 9 95871448 missense probably damaging 1.00
R7584:Atr UTSW 9 95942713 missense probably damaging 1.00
R7602:Atr UTSW 9 95907383 missense possibly damaging 0.64
R7633:Atr UTSW 9 95947118 missense probably damaging 1.00
R7640:Atr UTSW 9 95907293 splice site probably null
R7677:Atr UTSW 9 95885462 missense probably damaging 1.00
R7699:Atr UTSW 9 95875690 nonsense probably null
R7700:Atr UTSW 9 95875690 nonsense probably null
R7790:Atr UTSW 9 95874180 missense probably damaging 1.00
R8027:Atr UTSW 9 95865756 missense probably damaging 0.99
R8147:Atr UTSW 9 95899060 missense probably damaging 1.00
R8204:Atr UTSW 9 95935513 missense
R8306:Atr UTSW 9 95920370 missense
R8462:Atr UTSW 9 95867526 missense probably benign
R8716:Atr UTSW 9 95907415 missense probably benign 0.09
R8748:Atr UTSW 9 95932423 missense probably benign 0.00
R8795:Atr UTSW 9 95867531 missense probably damaging 1.00
R8891:Atr UTSW 9 95905760 missense probably benign 0.03
X0019:Atr UTSW 9 95940871 missense probably damaging 1.00
Z1088:Atr UTSW 9 95885320 splice site probably null
Z1177:Atr UTSW 9 95888100 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTATTGTACACATCAAAGTGCG -3'
(R):5'- AGGCAAACCACTGATTAGTAACATGG -3'

Sequencing Primer
(F):5'- TGTACACATCAAAGTGCGATCTC -3'
(R):5'- CCACTGATTAGTAACATGGATTTCAG -3'
Posted On2016-11-09