Mutagenetix > Incidental Mutation

Incidental Mutation 'R5031:Atr'

391697

Institutional Source

Beutler Lab

Gene Symbol

Atr

Ensembl Gene

ENSMUSG00000032409

Gene Name

ataxia telangiectasia and Rad3 related

Synonyms

MMRRC Submission

042622-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5031 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95857597-95951781 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 95865702 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 346 (K346E)

Ref Sequence

ENSEMBL: ENSMUSP00000149953 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034980] [ENSMUST00000215311]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034980
AA Change: K346E

PolyPhen 2 Score 0.492 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000034980
Gene: ENSMUSG00000032409
AA Change: K346E

Domain	Start	End	E-Value	Type
low complexity region	431	449	N/A	INTRINSIC
low complexity region	889	897	N/A	INTRINSIC
low complexity region	998	1013	N/A	INTRINSIC
UME	1119	1225	2.3e-43	SMART
low complexity region	1352	1362	N/A	INTRINSIC
Pfam:FAT	1771	2092	9.2e-51	PFAM
PI3Kc	2320	2630	7.51e-124	SMART
FATC	2609	2641	6.22e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185473

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186061

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187356

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189602

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191269

Predicted Effect

probably damaging
Transcript: ENSMUST00000215311
AA Change: K346E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

Meta Mutation Damage Score

0.1049

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 89.9%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs the PI3/PI4-kinase family, and is most closely related to ATM, a protein kinase encoded by the gene mutated in ataxia telangiectasia. This protein and ATM share similarity with Schizosaccharomyces pombe rad3, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This kinase has been shown to phosphorylate checkpoint kinase CHK1, checkpoint proteins RAD17, and RAD9, as well as tumor suppressor protein BRCA1. Mutations of this gene are associated with Seckel syndrome. An alternatively spliced transcript variant of this gene has been reported, however, its full length nature is not known. Transcript variants utilizing alternative polyA sites exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice heterozygous for a knock-out allele exhibit premature death and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	A	G	1: 105,664,514	N136S	probably damaging	Het
Abca13	A	T	11: 9,297,678	N2475I	probably damaging	Het
Acnat2	T	C	4: 49,380,631	K231R	probably damaging	Het
Ank1	C	T	8: 23,099,680	P599L	probably damaging	Het
Arhgef19	A	G	4: 141,250,810	E580G	probably damaging	Het
AU021092	T	C	16: 5,212,604	K309E	probably damaging	Het
Baz2b	T	C	2: 59,912,807	R1607G	probably benign	Het
Cct8	C	T	16: 87,487,538	V254M	probably damaging	Het
Cdca2	T	A	14: 67,713,153	I110F	probably damaging	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Dmkn	A	G	7: 30,764,236	I105V	probably benign	Het
Dock1	A	G	7: 135,152,246	D1584G	probably benign	Het
Epg5	G	A	18: 78,028,948	V2392I	probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Gsap	G	A	5: 21,242,826	S294N	possibly damaging	Het
Hectd2	A	G	19: 36,599,604	N142D	probably damaging	Het
Hmcn1	A	G	1: 150,588,257	C5091R	probably damaging	Het
Ifitm5	G	A	7: 140,950,104	R36*	probably null	Het
Ints2	G	A	11: 86,256,200	P40L	probably damaging	Het
Irs1	A	T	1: 82,286,967	L1176*	probably null	Het
Klhl29	C	T	12: 5,091,334	R550Q	probably benign	Het
Kyat1	A	G	2: 30,188,090	M134T	probably damaging	Het
Lrrk2	A	T	15: 91,700,619	N384Y	possibly damaging	Het
Magel2	T	C	7: 62,380,104	S919P	unknown	Het
Mettl16	A	T	11: 74,802,999	I279F	probably benign	Het
Mrgpra1	A	T	7: 47,335,237	Y231*	probably null	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Mut	T	C	17: 40,938,827	F231S	possibly damaging	Het
Mvp	A	C	7: 126,993,616	Y374*	probably null	Het
Nabp2	G	A	10: 128,409,628		probably benign	Het
Nos1	C	T	5: 117,879,313	P247L	probably benign	Het
Olfr1015	T	A	2: 85,785,718	L69*	probably null	Het
Olfr1115	C	A	2: 87,252,082	F48L	probably benign	Het
Pik3cb	C	T	9: 99,071,408	D441N	probably damaging	Het
Qrich1	C	T	9: 108,541,736	P464S	possibly damaging	Het
Rab17	A	T	1: 90,960,138		probably null	Het
Rspo3	A	T	10: 29,506,447	L77H	probably damaging	Het
Spn	G	T	7: 127,137,230	T35K	probably benign	Het
Sult1d1	T	A	5: 87,559,844	Y139F	possibly damaging	Het
Tbc1d32	C	A	10: 56,123,531	Q848H	probably damaging	Het
Tcaf3	A	G	6: 42,596,933	V115A	probably benign	Het
Tram1l1	T	A	3: 124,321,644	L151*	probably null	Het
Trappc12	T	A	12: 28,692,513	I682L	possibly damaging	Het
Trav6d-4	A	C	14: 52,753,599	T31P	probably damaging	Het
Trpm8	A	G	1: 88,348,188	T503A	probably benign	Het
Virma	T	A	4: 11,542,116	Y1567*	probably null	Het
Vmn1r228	T	A	17: 20,776,681	K192*	probably null	Het
Zfp521	T	A	18: 13,844,273	T1028S	possibly damaging	Het
Zfp583	T	A	7: 6,317,398	Q205L	probably benign	Het

Other mutations in Atr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00640:Atr	APN	9	95865052	missense	probably damaging	1.00
IGL00922:Atr	APN	9	95907345	missense	probably damaging	0.97
IGL01020:Atr	APN	9	95862783	missense	probably damaging	1.00
IGL01345:Atr	APN	9	95940949	missense	probably damaging	1.00
IGL01364:Atr	APN	9	95865624	missense	probably benign	0.29
IGL01456:Atr	APN	9	95950565	missense	possibly damaging	0.62
IGL01534:Atr	APN	9	95865546	missense	probably damaging	0.99
IGL01761:Atr	APN	9	95951448	splice site	probably benign
IGL01791:Atr	APN	9	95921781	missense	probably benign	0.05
IGL01831:Atr	APN	9	95870754	missense	probably benign	0.18
IGL01973:Atr	APN	9	95871674	missense	probably damaging	1.00
IGL02008:Atr	APN	9	95881420	splice site	probably benign
IGL02016:Atr	APN	9	95927175	missense	probably benign	0.09
IGL02035:Atr	APN	9	95866682	missense	probably benign	0.01
IGL02058:Atr	APN	9	95871487	missense	probably damaging	0.99
IGL02081:Atr	APN	9	95883205	missense	probably damaging	1.00
IGL02224:Atr	APN	9	95878629	missense	probably damaging	0.98
IGL02234:Atr	APN	9	95947250	splice site	probably benign
IGL02367:Atr	APN	9	95899141	nonsense	probably null
IGL02621:Atr	APN	9	95908400	missense	probably benign	0.00
IGL02728:Atr	APN	9	95936475	missense	probably damaging	1.00
IGL02833:Atr	APN	9	95862852	missense	probably damaging	1.00
IGL02939:Atr	APN	9	95865261	missense	probably benign
IGL03107:Atr	APN	9	95897730	missense	probably benign	0.28
IGL03382:Atr	APN	9	95920822	nonsense	probably null
PIT4812001:Atr	UTSW	9	95910649	missense	probably benign	0.41
R0042:Atr	UTSW	9	95927356	splice site	probably benign
R0042:Atr	UTSW	9	95927356	splice site	probably benign
R0281:Atr	UTSW	9	95937566	missense	probably benign	0.26
R0282:Atr	UTSW	9	95862798	missense	probably benign	0.12
R0512:Atr	UTSW	9	95935526	missense	probably damaging	0.99
R0547:Atr	UTSW	9	95899165	splice site	probably benign
R0567:Atr	UTSW	9	95865829	missense	probably benign	0.00
R0631:Atr	UTSW	9	95874777	missense	possibly damaging	0.92
R1116:Atr	UTSW	9	95867636	nonsense	probably null
R1171:Atr	UTSW	9	95907323	missense	probably damaging	1.00
R1241:Atr	UTSW	9	95950636	missense	probably benign	0.08
R1345:Atr	UTSW	9	95920355	missense	probably benign	0.25
R1400:Atr	UTSW	9	95862848	missense	probably benign	0.32
R1413:Atr	UTSW	9	95932442	missense	probably damaging	1.00
R1527:Atr	UTSW	9	95870043	missense	possibly damaging	0.82
R1557:Atr	UTSW	9	95871449	missense	probably damaging	1.00
R1591:Atr	UTSW	9	95945385	missense	probably damaging	1.00
R1602:Atr	UTSW	9	95951557	missense	probably damaging	1.00
R1605:Atr	UTSW	9	95936463	missense	probably damaging	1.00
R1670:Atr	UTSW	9	95861456	missense	probably benign	0.38
R1709:Atr	UTSW	9	95871076	missense	probably benign	0.00
R1728:Atr	UTSW	9	95897581	missense	probably benign	0.01
R1729:Atr	UTSW	9	95897581	missense	probably benign	0.01
R1739:Atr	UTSW	9	95897581	missense	probably benign	0.01
R1816:Atr	UTSW	9	95866694	missense	probably benign	0.00
R1824:Atr	UTSW	9	95936421	missense	probably damaging	1.00
R1844:Atr	UTSW	9	95905817	missense	probably benign	0.01
R1857:Atr	UTSW	9	95865097	missense	probably damaging	1.00
R1858:Atr	UTSW	9	95865097	missense	probably damaging	1.00
R1866:Atr	UTSW	9	95870605	splice site	probably null
R1913:Atr	UTSW	9	95866733	missense	probably benign	0.01
R2042:Atr	UTSW	9	95870022	missense	probably benign	0.00
R2210:Atr	UTSW	9	95907300	missense	probably damaging	1.00
R2230:Atr	UTSW	9	95920765	missense	probably damaging	1.00
R2361:Atr	UTSW	9	95871157	missense	probably benign	0.41
R2399:Atr	UTSW	9	95871599	missense	probably benign	0.00
R2431:Atr	UTSW	9	95862892	missense	probably benign	0.24
R2860:Atr	UTSW	9	95874243	missense	probably benign	0.07
R2861:Atr	UTSW	9	95874243	missense	probably benign	0.07
R3019:Atr	UTSW	9	95905818	missense	possibly damaging	0.52
R3684:Atr	UTSW	9	95920400	missense	probably damaging	0.96
R4155:Atr	UTSW	9	95888124	nonsense	probably null
R4295:Atr	UTSW	9	95874426	missense	probably benign	0.04
R4359:Atr	UTSW	9	95951536	missense	probably damaging	1.00
R4506:Atr	UTSW	9	95865237	missense	probably benign	0.21
R4523:Atr	UTSW	9	95862863	missense	probably damaging	1.00
R4536:Atr	UTSW	9	95874418	missense	probably benign	0.26
R4588:Atr	UTSW	9	95865667	missense	probably benign
R4646:Atr	UTSW	9	95871197	critical splice donor site	probably null
R4702:Atr	UTSW	9	95920355	missense	possibly damaging	0.92
R4743:Atr	UTSW	9	95862792	missense	probably benign	0.14
R4782:Atr	UTSW	9	95862797	missense	probably benign	0.00
R4928:Atr	UTSW	9	95907299	missense	probably damaging	1.00
R5138:Atr	UTSW	9	95937596	missense	probably benign	0.15
R5188:Atr	UTSW	9	95921725	missense	probably benign	0.00
R5219:Atr	UTSW	9	95881238	missense	probably damaging	0.99
R5307:Atr	UTSW	9	95878544	missense	probably benign	0.01
R5414:Atr	UTSW	9	95870704	missense	probably benign	0.00
R5628:Atr	UTSW	9	95874226	nonsense	probably null
R5664:Atr	UTSW	9	95905813	missense	probably benign	0.00
R5678:Atr	UTSW	9	95951487	nonsense	probably null
R5724:Atr	UTSW	9	95866588	missense	probably damaging	1.00
R5759:Atr	UTSW	9	95874402	missense	probably benign	0.01
R5763:Atr	UTSW	9	95945123	missense	probably benign	0.04
R5922:Atr	UTSW	9	95903682	missense	probably benign	0.00
R6051:Atr	UTSW	9	95908369	missense	possibly damaging	0.85
R6161:Atr	UTSW	9	95865319	missense	probably benign
R6171:Atr	UTSW	9	95881271	nonsense	probably null
R6532:Atr	UTSW	9	95908408	missense	probably benign
R6774:Atr	UTSW	9	95927213	missense	probably benign	0.00
R6894:Atr	UTSW	9	95927197	missense	probably damaging	1.00
R6930:Atr	UTSW	9	95866635	missense	probably benign	0.21
R7018:Atr	UTSW	9	95866694	missense	probably benign	0.17
R7056:Atr	UTSW	9	95862863	missense	probably damaging	1.00
R7103:Atr	UTSW	9	95865372	missense	probably damaging	0.98
R7154:Atr	UTSW	9	95865045	missense	probably benign
R7157:Atr	UTSW	9	95869900	missense	probably benign	0.00
R7188:Atr	UTSW	9	95862791	nonsense	probably null
R7189:Atr	UTSW	9	95862791	nonsense	probably null
R7300:Atr	UTSW	9	95865370	missense	probably benign	0.00
R7337:Atr	UTSW	9	95871448	missense	probably damaging	1.00
R7584:Atr	UTSW	9	95942713	missense	probably damaging	1.00
R7602:Atr	UTSW	9	95907383	missense	possibly damaging	0.64
R7633:Atr	UTSW	9	95947118	missense	probably damaging	1.00
R7640:Atr	UTSW	9	95907293	splice site	probably null
R7677:Atr	UTSW	9	95885462	missense	probably damaging	1.00
R7699:Atr	UTSW	9	95875690	nonsense	probably null
R7700:Atr	UTSW	9	95875690	nonsense	probably null
R7790:Atr	UTSW	9	95874180	missense	probably damaging	1.00
R8027:Atr	UTSW	9	95865756	missense	probably damaging	0.99
R8147:Atr	UTSW	9	95899060	missense	probably damaging	1.00
R8204:Atr	UTSW	9	95935513	missense
R8306:Atr	UTSW	9	95920370	missense
R8462:Atr	UTSW	9	95867526	missense	probably benign
R8716:Atr	UTSW	9	95907415	missense	probably benign	0.09
R8748:Atr	UTSW	9	95932423	missense	probably benign	0.00
R8795:Atr	UTSW	9	95867531	missense	probably damaging	1.00
R8891:Atr	UTSW	9	95905760	missense	probably benign	0.03
R8976:Atr	UTSW	9	95890766	missense	probably benign	0.00
R9024:Atr	UTSW	9	95907363	missense	possibly damaging	0.93
R9116:Atr	UTSW	9	95865798	missense	probably benign	0.00
R9523:Atr	UTSW	9	95910557	missense	possibly damaging	0.89
R9524:Atr	UTSW	9	95910557	missense	possibly damaging	0.89
R9525:Atr	UTSW	9	95910557	missense	possibly damaging	0.89
R9527:Atr	UTSW	9	95885376	missense	probably damaging	1.00
R9563:Atr	UTSW	9	95920780	missense	probably damaging	0.98
R9629:Atr	UTSW	9	95865045	missense	probably benign
R9642:Atr	UTSW	9	95939241	missense	probably damaging	1.00
R9652:Atr	UTSW	9	95874834	missense	probably damaging	1.00
R9660:Atr	UTSW	9	95914997	missense	probably benign	0.40
R9678:Atr	UTSW	9	95910557	missense	possibly damaging	0.89
R9728:Atr	UTSW	9	95914997	missense	probably benign	0.40
R9731:Atr	UTSW	9	95865039	missense	possibly damaging	0.52
R9732:Atr	UTSW	9	95861385	missense	probably damaging	1.00
R9749:Atr	UTSW	9	95937650	critical splice donor site	probably null
X0019:Atr	UTSW	9	95940871	missense	probably damaging	1.00
Z1088:Atr	UTSW	9	95885320	splice site	probably null
Z1177:Atr	UTSW	9	95888100	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTGGAATGGATGCTGACCAATTG -3'
(R):5'- CCCTTGACATGCCATTATTGTAAG -3'

Sequencing Primer
(F):5'- TGGATGCTGACCAATTGAAATTG -3'
(R):5'- TGCCATTATTGTAAGATGTTCTCTC -3'

Posted On

2016-06-06