Incidental Mutation 'R5690:Nt5c1a'
ID443619
Institutional Source Beutler Lab
Gene Symbol Nt5c1a
Ensembl Gene ENSMUSG00000054958
Gene Name5'-nucleotidase, cytosolic IA
SynonymsLOC230718, Cn1a
MMRRC Submission 043323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R5690 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location123201504-123216275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123215939 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 277 (V277E)
Ref Sequence ENSEMBL: ENSMUSP00000069422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068262]
Predicted Effect probably damaging
Transcript: ENSMUST00000068262
AA Change: V277E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069422
Gene: ENSMUSG00000054958
AA Change: V277E

DomainStartEndE-ValueType
low complexity region 35 45 N/A INTRINSIC
Pfam:5-nucleotidase 78 350 3.5e-109 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic nucleotidases, such as NT5C1A, dephosphorylate nucleoside monophosphates (Hunsucker et al., 2001 [PubMed 11133996]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik G A 2: 156,865,314 V58I probably benign Het
2810474O19Rik T C 6: 149,328,237 L927S possibly damaging Het
4930533K18Rik A G 10: 70,923,314 probably benign Het
Acadl T C 1: 66,853,286 Y126C probably damaging Het
Ak6 A G 13: 100,655,621 probably null Het
Ap1s1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 5: 137,037,379 probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp6v1e1 A T 6: 120,808,356 probably null Het
Axin1 A G 17: 26,194,937 Y792C probably damaging Het
C1s2 T C 6: 124,631,037 N233S probably benign Het
Ccer2 C A 7: 28,756,204 probably benign Het
Cfap46 A G 7: 139,638,353 S1481P probably benign Het
Cspg4 A T 9: 56,898,735 T2277S probably benign Het
Ctsl T A 13: 64,365,208 N300I probably damaging Het
Dnah2 T C 11: 69,491,544 I1247V probably benign Het
Dsg3 A T 18: 20,522,051 Q135L probably benign Het
Efcab14 G A 4: 115,760,047 V318M possibly damaging Het
Etl4 G A 2: 20,805,836 S910N probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frmd4b T C 6: 97,353,203 E133G possibly damaging Het
Herc2 T C 7: 56,157,705 F2514S probably benign Het
Il18rap A G 1: 40,537,112 D261G possibly damaging Het
Klk1b16 A G 7: 44,140,894 probably null Het
Lrp1b A C 2: 40,750,894 probably null Het
Mrpl45 C A 11: 97,321,586 probably benign Het
Myh13 A G 11: 67,329,275 E150G probably damaging Het
Nbas T A 12: 13,336,284 V737D probably damaging Het
Ncr1 T C 7: 4,338,297 Y59H probably damaging Het
Ogfod1 T A 8: 94,058,141 S343T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pnpla1 A T 17: 28,878,372 I171F probably damaging Het
Rdh8 A G 9: 20,825,489 N259S probably damaging Het
Slc22a12 A G 19: 6,536,848 M496T probably benign Het
Slc8b1 G A 5: 120,513,205 W10* probably null Het
Smarcc2 G A 10: 128,484,407 G887S probably damaging Het
Smc1b A G 15: 85,112,773 S549P probably damaging Het
Synj2 A G 17: 6,035,527 M1181V probably benign Het
Tbx15 T C 3: 99,308,850 S76P probably damaging Het
Tbx2 A T 11: 85,837,053 I271F probably damaging Het
Thap4 A G 1: 93,716,630 probably null Het
Tmc2 A G 2: 130,232,386 Y333C probably damaging Het
Trcg1 C T 9: 57,241,811 P222L probably benign Het
Tubb3 T C 8: 123,421,306 V326A probably benign Het
Unc80 A C 1: 66,640,572 I2101L probably benign Het
Vmn1r19 T C 6: 57,404,795 L111S probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Xpo4 T C 14: 57,590,989 I805V probably benign Het
Other mutations in Nt5c1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Nt5c1a APN 4 123216169 missense probably damaging 1.00
IGL02035:Nt5c1a APN 4 123214102 missense possibly damaging 0.93
IGL02437:Nt5c1a APN 4 123214241 missense probably benign 0.25
IGL02877:Nt5c1a APN 4 123216074 missense probably damaging 1.00
R1628:Nt5c1a UTSW 4 123208491 missense possibly damaging 0.65
R2273:Nt5c1a UTSW 4 123216080 missense probably damaging 1.00
R2275:Nt5c1a UTSW 4 123216080 missense probably damaging 1.00
R4433:Nt5c1a UTSW 4 123215896 missense probably benign 0.01
R4826:Nt5c1a UTSW 4 123208572 missense probably damaging 1.00
R5328:Nt5c1a UTSW 4 123208993 missense possibly damaging 0.90
R5883:Nt5c1a UTSW 4 123216256 utr 3 prime probably null
R7162:Nt5c1a UTSW 4 123214105 missense probably benign
R7390:Nt5c1a UTSW 4 123208479 missense probably benign 0.01
R7823:Nt5c1a UTSW 4 123208572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATCACAGAGGCTTTAGGATGAC -3'
(R):5'- ACACCATAAGGCACATGGGC -3'

Sequencing Primer
(F):5'- AGGCTTTAGGATGACGGGGG -3'
(R):5'- ACCGTGCCCATCTCCTGAG -3'
Posted On2016-11-09