Incidental Mutation 'R5693:Rnf183'
ID443758
Institutional Source Beutler Lab
Gene Symbol Rnf183
Ensembl Gene ENSMUSG00000063851
Gene Namering finger protein 183
Synonyms5830442J12Rik
MMRRC Submission 043180-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5693 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location62427540-62435252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62428516 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 15 (V15A)
Ref Sequence ENSEMBL: ENSMUSP00000103079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079420] [ENSMUST00000084524] [ENSMUST00000107454] [ENSMUST00000107455]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079420
AA Change: V15A

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078389
Gene: ENSMUSG00000063851
AA Change: V15A

DomainStartEndE-ValueType
RING 13 59 3.78e-5 SMART
transmembrane domain 160 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084524
SMART Domains Protein: ENSMUSP00000081572
Gene: ENSMUSG00000066148

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SFM 102 154 8.92e-25 SMART
WD40 219 258 1.14e-3 SMART
WD40 261 308 1.75e-4 SMART
WD40 311 350 5.18e-7 SMART
WD40 353 392 8.04e-4 SMART
WD40 395 434 2.57e-11 SMART
WD40 437 477 2.93e-6 SMART
WD40 480 519 1.74e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107454
AA Change: V15A

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103078
Gene: ENSMUSG00000063851
AA Change: V15A

DomainStartEndE-ValueType
RING 13 59 3.78e-5 SMART
transmembrane domain 160 182 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107455
AA Change: V15A

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103079
Gene: ENSMUSG00000063851
AA Change: V15A

DomainStartEndE-ValueType
RING 13 59 3.78e-5 SMART
transmembrane domain 160 182 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,316,233 I3071V probably benign Het
Abcb8 C T 5: 24,400,139 R108C possibly damaging Het
Abr T C 11: 76,463,577 N236S probably damaging Het
Adcy6 T C 15: 98,603,989 Y248C probably damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Chd6 A T 2: 160,965,265 S2010T probably benign Het
Dcc G A 18: 71,575,082 T521I probably damaging Het
Dmrtb1 G A 4: 107,684,169 probably benign Het
Evc A G 5: 37,320,240 V365A possibly damaging Het
Gata4 A G 14: 63,241,145 Y2H probably damaging Het
Gpc1 A G 1: 92,857,899 N437S probably damaging Het
Lifr T C 15: 7,175,560 V426A probably damaging Het
Lpin3 A G 2: 160,895,400 I122M probably benign Het
Muc4 A G 16: 32,776,807 N3174D possibly damaging Het
Myo6 G A 9: 80,266,180 R534H probably damaging Het
Nectin2 T C 7: 19,724,869 D339G probably benign Het
Olfr798 T C 10: 129,625,527 D178G probably damaging Het
Oprd1 G A 4: 132,144,410 probably benign Het
Orc1 G A 4: 108,613,079 V751I probably benign Het
Pacs2 T C 12: 113,049,906 S175P probably damaging Het
Pik3r5 C T 11: 68,494,251 R661C probably damaging Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Prkar1b A G 5: 139,127,645 V40A possibly damaging Het
Ptprf G A 4: 118,236,177 R90* probably null Het
Rasef T C 4: 73,769,839 M26V probably damaging Het
Rfx1 C A 8: 84,073,904 Q45K unknown Het
Slc10a2 C A 8: 5,105,128 C19F probably damaging Het
Slc14a2 T A 18: 78,147,014 I907F probably benign Het
Snx16 T C 3: 10,420,258 I293V probably benign Het
Srcap C A 7: 127,519,816 A97E probably damaging Het
Thyn1 G T 9: 27,005,215 probably null Het
Tiparp T C 3: 65,553,492 I634T possibly damaging Het
Tjp1 G A 7: 65,342,663 A156V possibly damaging Het
Tmem168 T C 6: 13,602,321 M349V probably benign Het
Tyro3 T G 2: 119,810,868 F519L probably damaging Het
Vmn1r167 A T 7: 23,505,221 Y123* probably null Het
Vmn1r183 C T 7: 24,054,802 T10I possibly damaging Het
Zfp654 T C 16: 64,785,926 T97A probably benign Het
Other mutations in Rnf183
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Rnf183 APN 4 62428373 missense probably benign 0.16
R1438:Rnf183 UTSW 4 62428523 missense probably damaging 1.00
R2178:Rnf183 UTSW 4 62428096 missense probably benign 0.02
R5106:Rnf183 UTSW 4 62428228 missense probably damaging 1.00
R5637:Rnf183 UTSW 4 62428150 missense probably benign
R6882:Rnf183 UTSW 4 62428024 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGCATGGCAGTGTCTGTAG -3'
(R):5'- TCCTCCACCTGTGACATGTG -3'

Sequencing Primer
(F):5'- GTCTGTAGGCAAGTCAGTGAC -3'
(R):5'- CACCTGTGACATGTGGGTGGATAG -3'
Posted On2016-11-09