Incidental Mutation 'R5857:Npnt'
ID454944
Institutional Source Beutler Lab
Gene Symbol Npnt
Ensembl Gene ENSMUSG00000040998
Gene Namenephronectin
Synonyms1110009H02Rik, POEM
MMRRC Submission 044069-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5857 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location132881745-132950291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132908349 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 167 (C167S)
Ref Sequence ENSEMBL: ENSMUSP00000040684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042729] [ENSMUST00000042744] [ENSMUST00000093971] [ENSMUST00000117164] [ENSMUST00000117456] [ENSMUST00000117811]
Predicted Effect probably damaging
Transcript: ENSMUST00000042729
AA Change: C184S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040071
Gene: ENSMUSG00000040998
AA Change: C184S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 76 104 1.53e-1 SMART
EGF_CA 106 145 1.85e-9 SMART
EGF 149 185 1.73e1 SMART
EGF 189 230 7.53e-1 SMART
EGF_CA 231 271 5.31e-10 SMART
low complexity region 324 383 N/A INTRINSIC
Pfam:MAM 439 578 8.2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042744
AA Change: C167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040684
Gene: ENSMUSG00000040998
AA Change: C167S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 7.6e-4 SMART
EGF_CA 89 128 9e-12 SMART
EGF 132 168 8.5e-2 SMART
EGF 172 213 3.5e-3 SMART
EGF_CA 214 254 2.6e-12 SMART
low complexity region 307 366 N/A INTRINSIC
MAM 417 560 1.4e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093971
AA Change: C215S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091505
Gene: ENSMUSG00000040998
AA Change: C215S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 76 104 1.53e-1 SMART
EGF_CA 137 176 1.85e-9 SMART
EGF 180 216 1.73e1 SMART
EGF 220 261 7.53e-1 SMART
EGF_CA 262 302 5.31e-10 SMART
low complexity region 355 414 N/A INTRINSIC
Pfam:MAM 470 609 1.9e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117164
AA Change: C198S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113419
Gene: ENSMUSG00000040998
AA Change: C198S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 1.53e-1 SMART
EGF_CA 120 159 1.85e-9 SMART
EGF 163 199 1.73e1 SMART
EGF 203 244 7.53e-1 SMART
EGF_CA 245 285 5.31e-10 SMART
low complexity region 338 397 N/A INTRINSIC
Pfam:MAM 453 592 8.6e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117456
AA Change: C63S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112816
Gene: ENSMUSG00000040998
AA Change: C63S

DomainStartEndE-ValueType
EGF 28 64 1.73e1 SMART
EGF 68 109 7.53e-1 SMART
EGF_CA 110 150 5.31e-10 SMART
low complexity region 203 262 N/A INTRINSIC
Pfam:MAM 318 457 5.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117811
AA Change: C167S

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113752
Gene: ENSMUSG00000040998
AA Change: C167S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 1.53e-1 SMART
EGF_CA 89 128 1.85e-9 SMART
EGF 132 168 1.73e1 SMART
EGF 172 213 7.53e-1 SMART
EGF_CA 214 254 5.31e-10 SMART
low complexity region 307 366 N/A INTRINSIC
Pfam:MAM 393 532 3.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132732
Meta Mutation Damage Score 0.9703 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 95% (55/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele frequently exhibit kidney agenesis or hypoplasia attributed to a delay in the invasion of the metanephric mesenchyme by the ureteric bud at an early stage of kidney development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,449,525 I266V probably benign Het
Anks6 C T 4: 47,039,736 A492T possibly damaging Het
Ano1 A T 7: 144,637,103 C415S probably benign Het
Anxa3 T A 5: 96,828,792 probably null Het
Apob T C 12: 8,015,397 V4089A probably benign Het
Arhgap23 C T 11: 97,451,579 A229V possibly damaging Het
Atad5 T C 11: 80,131,329 F1447L probably benign Het
Btbd8 T A 5: 107,461,532 D212E probably damaging Het
Ccdc38 G T 10: 93,562,833 A58S possibly damaging Het
Cep112 T C 11: 108,531,471 probably benign Het
Col4a2 G A 8: 11,425,442 G622D probably damaging Het
Crhbp T A 13: 95,442,232 Q134L probably benign Het
Ctnnbl1 T C 2: 157,789,098 S145P probably damaging Het
Cyp4f16 T A 17: 32,537,024 L9Q probably damaging Het
Dchs2 T G 3: 83,270,313 I891S possibly damaging Het
Disp3 A T 4: 148,249,183 V1066D probably benign Het
Dlgap1 A G 17: 70,815,393 probably benign Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Efl1 T A 7: 82,763,189 C929S probably benign Het
Fam129b T A 2: 32,909,908 N82K probably benign Het
Gatb T C 3: 85,575,932 F82S probably damaging Het
Gk5 C A 9: 96,119,455 S2* probably null Het
Gpr135 G A 12: 72,070,840 A51V probably benign Het
Hoxa9 T A 6: 52,224,297 N255Y probably damaging Het
Igkv8-18 T C 6: 70,355,920 V15A probably benign Het
Ism2 T C 12: 87,280,061 D368G probably damaging Het
Krtap6-2 A T 16: 89,419,642 S146T unknown Het
Lama1 T A 17: 67,807,843 L2329H probably damaging Het
Llgl2 T A 11: 115,850,281 I507N probably damaging Het
Lmna GCTGCCCACAC GC 3: 88,482,531 probably benign Het
Lrfn3 A T 7: 30,359,438 I454N possibly damaging Het
Mdn1 C A 4: 32,670,646 T437K probably benign Het
Nat8f3 T C 6: 85,761,753 Y9C probably damaging Het
Nlrp4d C A 7: 10,382,377 G156V noncoding transcript Het
Nr3c2 A G 8: 76,908,867 N199S possibly damaging Het
Olfr248 T G 1: 174,391,108 I13R possibly damaging Het
Olfr870 C T 9: 20,171,239 D111N probably damaging Het
Olfr884 T G 9: 38,047,753 V177G probably benign Het
Pabpc1l T A 2: 164,044,255 probably null Het
Pi4ka A G 16: 17,358,984 I366T probably benign Het
Prl7a1 A T 13: 27,640,701 D50E probably damaging Het
Rad52 T G 6: 119,911,007 probably null Het
Rbm19 T A 5: 120,132,942 L610Q probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Scube1 G T 15: 83,607,260 probably benign Het
Sptbn4 G T 7: 27,418,713 R314S possibly damaging Het
Togaram1 T A 12: 64,995,557 I1130K possibly damaging Het
Tsc2 T C 17: 24,600,007 E1352G probably damaging Het
Ube2d2a A G 18: 35,805,543 T142A probably benign Het
Vps18 T C 2: 119,297,533 Y946H probably damaging Het
Other mutations in Npnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Npnt APN 3 132904657 critical splice donor site probably null
IGL01457:Npnt APN 3 132885982 missense probably damaging 1.00
IGL01954:Npnt APN 3 132909963 missense probably damaging 1.00
IGL01999:Npnt APN 3 132908399 missense probably damaging 1.00
IGL02012:Npnt APN 3 132908397 missense probably damaging 1.00
IGL02025:Npnt APN 3 132890762 critical splice donor site probably null
IGL02637:Npnt APN 3 132884510 missense possibly damaging 0.90
R0234:Npnt UTSW 3 132914414 missense possibly damaging 0.82
R0234:Npnt UTSW 3 132914414 missense possibly damaging 0.82
R1680:Npnt UTSW 3 132906802 missense probably benign 0.00
R1729:Npnt UTSW 3 132914397 nonsense probably null
R1773:Npnt UTSW 3 132904693 missense possibly damaging 0.62
R1980:Npnt UTSW 3 132948132 missense probably benign 0.04
R1982:Npnt UTSW 3 132948132 missense probably benign 0.04
R2338:Npnt UTSW 3 132891409 missense probably damaging 1.00
R3800:Npnt UTSW 3 132906763 missense probably damaging 1.00
R4739:Npnt UTSW 3 132904691 missense possibly damaging 0.93
R4790:Npnt UTSW 3 132890762 critical splice donor site probably benign
R5008:Npnt UTSW 3 132906457 missense probably damaging 1.00
R5446:Npnt UTSW 3 132908369 missense probably damaging 1.00
R5471:Npnt UTSW 3 132914387 missense probably benign 0.05
R5538:Npnt UTSW 3 132904963 missense probably damaging 1.00
R5673:Npnt UTSW 3 132917497 missense probably damaging 0.97
R5683:Npnt UTSW 3 132906840 splice site probably null
R5827:Npnt UTSW 3 132906775 missense possibly damaging 0.89
R5910:Npnt UTSW 3 132906418 missense probably damaging 1.00
R6208:Npnt UTSW 3 132950013 unclassified probably benign
R6358:Npnt UTSW 3 132904718 missense probably benign 0.18
R6875:Npnt UTSW 3 132909910 missense probably damaging 1.00
R7025:Npnt UTSW 3 132908396 missense probably damaging 1.00
R7145:Npnt UTSW 3 132909931 missense probably benign 0.01
R7166:Npnt UTSW 3 132948128 missense probably damaging 1.00
R7287:Npnt UTSW 3 132906802 missense probably benign 0.00
R7344:Npnt UTSW 3 132908339 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGTGCTCTGTTTCCTGCAGG -3'
(R):5'- CACCTATTGTTGGACACGTGAG -3'

Sequencing Primer
(F):5'- CCTGCAGGGTTTTTGCAC -3'
(R):5'- CCTATTGTTGGACACGTGAGAAAAG -3'
Posted On2017-02-10