Incidental Mutation 'R5857:Efl1'
ID454958
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Nameelongation factor like GPTase 1
Synonyms6030468D11Rik, 4932434J20Rik, D7Ertd791e, Eftud1
MMRRC Submission 044069-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R5857 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location82648614-82777852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82763189 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 929 (C929S)
Ref Sequence ENSEMBL: ENSMUSP00000137061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]
Predicted Effect probably benign
Transcript: ENSMUST00000039881
AA Change: C929S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: C929S

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179489
AA Change: C929S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: C929S

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Meta Mutation Damage Score 0.0680 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 95% (55/58)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,449,525 I266V probably benign Het
Anks6 C T 4: 47,039,736 A492T possibly damaging Het
Ano1 A T 7: 144,637,103 C415S probably benign Het
Anxa3 T A 5: 96,828,792 probably null Het
Apob T C 12: 8,015,397 V4089A probably benign Het
Arhgap23 C T 11: 97,451,579 A229V possibly damaging Het
Atad5 T C 11: 80,131,329 F1447L probably benign Het
Btbd8 T A 5: 107,461,532 D212E probably damaging Het
Ccdc38 G T 10: 93,562,833 A58S possibly damaging Het
Cep112 T C 11: 108,531,471 probably benign Het
Col4a2 G A 8: 11,425,442 G622D probably damaging Het
Crhbp T A 13: 95,442,232 Q134L probably benign Het
Ctnnbl1 T C 2: 157,789,098 S145P probably damaging Het
Cyp4f16 T A 17: 32,537,024 L9Q probably damaging Het
Dchs2 T G 3: 83,270,313 I891S possibly damaging Het
Disp3 A T 4: 148,249,183 V1066D probably benign Het
Dlgap1 A G 17: 70,815,393 probably benign Het
Dnah3 TTCCTC TTC 7: 119,951,021 probably benign Het
Fam129b T A 2: 32,909,908 N82K probably benign Het
Gatb T C 3: 85,575,932 F82S probably damaging Het
Gk5 C A 9: 96,119,455 S2* probably null Het
Gpr135 G A 12: 72,070,840 A51V probably benign Het
Hoxa9 T A 6: 52,224,297 N255Y probably damaging Het
Igkv8-18 T C 6: 70,355,920 V15A probably benign Het
Ism2 T C 12: 87,280,061 D368G probably damaging Het
Krtap6-2 A T 16: 89,419,642 S146T unknown Het
Lama1 T A 17: 67,807,843 L2329H probably damaging Het
Llgl2 T A 11: 115,850,281 I507N probably damaging Het
Lmna GCTGCCCACAC GC 3: 88,482,531 probably benign Het
Lrfn3 A T 7: 30,359,438 I454N possibly damaging Het
Mdn1 C A 4: 32,670,646 T437K probably benign Het
Nat8f3 T C 6: 85,761,753 Y9C probably damaging Het
Nlrp4d C A 7: 10,382,377 G156V noncoding transcript Het
Npnt A T 3: 132,908,349 C167S probably damaging Het
Nr3c2 A G 8: 76,908,867 N199S possibly damaging Het
Olfr248 T G 1: 174,391,108 I13R possibly damaging Het
Olfr870 C T 9: 20,171,239 D111N probably damaging Het
Olfr884 T G 9: 38,047,753 V177G probably benign Het
Pabpc1l T A 2: 164,044,255 probably null Het
Pi4ka A G 16: 17,358,984 I366T probably benign Het
Prl7a1 A T 13: 27,640,701 D50E probably damaging Het
Rad52 T G 6: 119,911,007 probably null Het
Rbm19 T A 5: 120,132,942 L610Q probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Scube1 G T 15: 83,607,260 probably benign Het
Sptbn4 G T 7: 27,418,713 R314S possibly damaging Het
Togaram1 T A 12: 64,995,557 I1130K possibly damaging Het
Tsc2 T C 17: 24,600,007 E1352G probably damaging Het
Ube2d2a A G 18: 35,805,543 T142A probably benign Het
Vps18 T C 2: 119,297,533 Y946H probably damaging Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82658111 missense probably damaging 1.00
IGL00696:Efl1 APN 7 82651872 splice site probably benign
IGL01344:Efl1 APN 7 82681480 splice site probably benign
IGL01871:Efl1 APN 7 82763319 missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82697976 missense probably benign 0.17
IGL02104:Efl1 APN 7 82658055 critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82686691 missense probably benign
IGL02484:Efl1 APN 7 82683039 missense probably damaging 0.98
IGL03140:Efl1 APN 7 82692881 missense probably benign 0.00
IGL03188:Efl1 APN 7 82671701 missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82651886 missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82658165 missense probably benign 0.14
R0148:Efl1 UTSW 7 82671670 missense probably damaging 1.00
R0226:Efl1 UTSW 7 82693011 splice site probably benign
R0638:Efl1 UTSW 7 82651887 missense probably damaging 1.00
R0684:Efl1 UTSW 7 82651886 missense probably damaging 1.00
R1018:Efl1 UTSW 7 82763013 missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82671728 missense probably damaging 1.00
R1720:Efl1 UTSW 7 82683721 missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82763117 nonsense probably null
R1973:Efl1 UTSW 7 82762877 missense probably damaging 1.00
R2016:Efl1 UTSW 7 82753709 missense probably damaging 1.00
R2124:Efl1 UTSW 7 82692913 missense probably damaging 1.00
R2290:Efl1 UTSW 7 82777670 missense probably damaging 1.00
R2415:Efl1 UTSW 7 82697967 missense probably damaging 1.00
R3545:Efl1 UTSW 7 82762810 missense probably benign 0.00
R3688:Efl1 UTSW 7 82762970 missense probably benign 0.00
R4092:Efl1 UTSW 7 82762827 missense probably benign 0.00
R4207:Efl1 UTSW 7 82750816 missense probably damaging 0.98
R4347:Efl1 UTSW 7 82697966 missense probably damaging 1.00
R4425:Efl1 UTSW 7 82763283 missense probably damaging 0.99
R4816:Efl1 UTSW 7 82671719 missense probably damaging 1.00
R4858:Efl1 UTSW 7 82671627 missense probably damaging 1.00
R5077:Efl1 UTSW 7 82658087 missense probably damaging 1.00
R5185:Efl1 UTSW 7 82772499 missense probably damaging 1.00
R5319:Efl1 UTSW 7 82674506 missense probably damaging 1.00
R5771:Efl1 UTSW 7 82692524 missense probably benign 0.26
R5956:Efl1 UTSW 7 82651899 missense probably damaging 1.00
R6433:Efl1 UTSW 7 82674568 missense probably damaging 1.00
R7131:Efl1 UTSW 7 82658064 missense probably damaging 1.00
R7143:Efl1 UTSW 7 82762680 missense probably damaging 1.00
R7312:Efl1 UTSW 7 82681444 missense probably benign 0.10
R7409:Efl1 UTSW 7 82697913 missense probably damaging 0.98
R7422:Efl1 UTSW 7 82681379 missense probably damaging 1.00
R7453:Efl1 UTSW 7 82681467 missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82683049 missense probably damaging 1.00
R7884:Efl1 UTSW 7 82658099 missense probably damaging 1.00
Z1088:Efl1 UTSW 7 82692850 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAATAGCATTGTGAGTGGCTTC -3'
(R):5'- GTGGCCATGATGTCACATGTG -3'

Sequencing Primer
(F):5'- AGTGGCTTCCAGCTTGC -3'
(R):5'- TGTACATAGCTGCCATCAGG -3'
Posted On2017-02-10