Incidental Mutation 'R5902:Sis'
ID456361
Institutional Source Beutler Lab
Gene Symbol Sis
Ensembl Gene ENSMUSG00000027790
Gene Namesucrase isomaltase (alpha-glucosidase)
SynonymsSi-s, sucrase-isomaltase
MMRRC Submission 044100-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5902 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location72888557-72967863 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 72960256 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]
Predicted Effect probably null
Transcript: ENSMUST00000094190
SMART Domains Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167334
SMART Domains Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170445
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.1%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,708,937 M1V probably null Het
Abca13 T A 11: 9,297,177 L2308H probably damaging Het
Abcc8 T C 7: 46,115,039 T1161A probably benign Het
Acin1 T A 14: 54,663,673 T659S probably benign Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Alkbh8 A G 9: 3,385,414 K569E probably benign Het
Anxa3 A T 5: 96,812,853 K39* probably null Het
Aoc2 A G 11: 101,329,246 E659G probably damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
AU022252 T C 4: 119,226,904 D104G probably benign Het
Car6 T C 4: 150,187,499 Y231C possibly damaging Het
Ccdc94 A G 17: 55,962,077 T62A probably damaging Het
Cdh10 T G 15: 18,985,255 probably null Het
Cebpz A C 17: 78,925,937 M787R probably benign Het
Chst2 A G 9: 95,405,609 L228P probably damaging Het
Clic4 T C 4: 135,272,558 K11R probably benign Het
Col6a3 C T 1: 90,802,199 probably null Het
Commd7 T A 2: 153,621,817 T144S probably damaging Het
Ctla2a T A 13: 60,935,020 *138Y probably null Het
Dhx33 A T 11: 70,989,131 V351D probably damaging Het
Dnah9 G A 11: 66,025,187 T2313I probably benign Het
Dspp A T 5: 104,178,111 D780V unknown Het
Dync1li1 A G 9: 114,717,861 probably null Het
E2f3 C T 13: 29,985,267 probably benign Het
Fan1 T C 7: 64,373,322 probably null Het
Gart A G 16: 91,628,527 S617P probably damaging Het
Ggcx A G 6: 72,429,996 N705S possibly damaging Het
Gm4841 A T 18: 60,270,796 V75E probably damaging Het
Greb1l A G 18: 10,538,302 E1105G probably benign Het
Hr C A 14: 70,557,791 Q288K probably benign Het
Hus1 T C 11: 9,010,669 probably benign Het
Ifi47 C A 11: 49,095,386 probably null Het
Irf2bp1 T C 7: 19,004,447 V4A probably benign Het
Kprp C T 3: 92,824,528 C405Y unknown Het
Lacc1 T C 14: 77,034,799 I186V possibly damaging Het
Lifr A G 15: 7,190,750 T954A probably benign Het
Lonrf2 T C 1: 38,807,093 M333V probably benign Het
Mthfd1 A T 12: 76,291,052 H400L probably benign Het
Myh4 A G 11: 67,250,907 K864R possibly damaging Het
Nup50 C T 15: 84,935,440 A305V probably benign Het
Olfr1247 T A 2: 89,609,251 I284L probably damaging Het
Olfr1294 C T 2: 111,537,394 M298I probably benign Het
Pax4 G T 6: 28,447,127 Q3K probably benign Het
Pced1b T G 15: 97,385,089 Y336* probably null Het
Postn C A 3: 54,372,089 N329K probably benign Het
Prickle1 T C 15: 93,510,672 E82G probably null Het
Prtn3 T C 10: 79,882,932 Y241H probably damaging Het
Rasgrf2 A T 13: 91,919,892 I260K probably damaging Het
Sh3glb1 T C 3: 144,712,670 N44S possibly damaging Het
Slc4a9 A G 18: 36,529,333 probably null Het
Slc4a9 A T 18: 36,531,507 D406V probably damaging Het
Slc8a1 C T 17: 81,408,082 G841R probably damaging Het
Smn1 C T 13: 100,126,904 P60L probably benign Het
Snai1 G A 2: 167,542,010 C241Y probably damaging Het
Spock3 A G 8: 63,355,302 D411G unknown Het
Szt2 T A 4: 118,391,503 T607S probably benign Het
Tcap A T 11: 98,383,847 M1L probably benign Het
Tex29 C A 8: 11,854,276 probably benign Het
Tex29 C T 8: 11,854,277 probably benign Het
Tex29 A T 8: 11,855,723 probably benign Het
Tln2 T C 9: 67,362,717 T467A probably benign Het
Trim34a C T 7: 104,261,121 Q377* probably null Het
Ube2q1 T A 3: 89,776,180 L144* probably null Het
Vps13c A G 9: 67,934,447 E1917G probably benign Het
Wdr19 T A 5: 65,227,139 N525K probably benign Het
Wdr3 A T 3: 100,144,491 probably benign Het
Wnt5b T A 6: 119,448,238 H6L probably benign Het
Zdbf2 T C 1: 63,306,526 S1355P possibly damaging Het
Zfp11 T A 5: 129,657,912 I162F probably damaging Het
Zpbp T C 11: 11,415,332 T172A probably benign Het
Other mutations in Sis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Sis APN 3 72946636 missense probably benign
IGL00715:Sis APN 3 72934124 missense probably damaging 1.00
IGL00721:Sis APN 3 72943579 missense probably damaging 1.00
IGL00766:Sis APN 3 72907237 splice site probably benign
IGL00783:Sis APN 3 72946632 missense probably benign
IGL00805:Sis APN 3 72934199 missense probably benign 0.05
IGL00932:Sis APN 3 72940956 splice site probably benign
IGL01020:Sis APN 3 72966838 missense probably damaging 1.00
IGL01024:Sis APN 3 72911876 missense probably damaging 1.00
IGL01286:Sis APN 3 72941025 missense probably damaging 1.00
IGL01457:Sis APN 3 72961021 missense probably benign
IGL01514:Sis APN 3 72935920 splice site probably benign
IGL01986:Sis APN 3 72945212 missense probably damaging 1.00
IGL02110:Sis APN 3 72928699 nonsense probably null
IGL02132:Sis APN 3 72947471 missense probably benign 0.00
IGL02152:Sis APN 3 72888986 utr 3 prime probably benign
IGL02200:Sis APN 3 72943604 missense probably damaging 0.99
IGL02244:Sis APN 3 72956190 missense probably benign 0.19
IGL02307:Sis APN 3 72911834 splice site probably benign
IGL02374:Sis APN 3 72925456 missense probably benign 0.03
IGL02437:Sis APN 3 72919614 critical splice acceptor site probably null
IGL02571:Sis APN 3 72956304 splice site probably benign
IGL02601:Sis APN 3 72913210 missense probably benign 0.44
IGL03063:Sis APN 3 72928297 missense probably benign
IGL03382:Sis APN 3 72928719 missense probably benign 0.00
IGL03397:Sis APN 3 72935879 missense probably benign 0.44
PIT1430001:Sis UTSW 3 72922829 missense probably damaging 0.97
R0013:Sis UTSW 3 72910476 missense possibly damaging 0.65
R0013:Sis UTSW 3 72910476 missense possibly damaging 0.65
R0046:Sis UTSW 3 72932094 missense probably benign 0.01
R0094:Sis UTSW 3 72921437 missense probably damaging 1.00
R0096:Sis UTSW 3 72928267 missense probably damaging 1.00
R0505:Sis UTSW 3 72960296 missense probably benign 0.29
R0544:Sis UTSW 3 72951642 missense probably damaging 1.00
R0551:Sis UTSW 3 72925407 missense possibly damaging 0.79
R0617:Sis UTSW 3 72965605 missense probably damaging 1.00
R0698:Sis UTSW 3 72910498 missense probably damaging 1.00
R0701:Sis UTSW 3 72941045 missense probably damaging 1.00
R0704:Sis UTSW 3 72949822 missense possibly damaging 0.63
R0706:Sis UTSW 3 72952531 missense probably damaging 1.00
R0710:Sis UTSW 3 72952531 missense probably damaging 1.00
R0752:Sis UTSW 3 72952531 missense probably damaging 1.00
R0753:Sis UTSW 3 72952531 missense probably damaging 1.00
R0754:Sis UTSW 3 72952531 missense probably damaging 1.00
R0767:Sis UTSW 3 72952531 missense probably damaging 1.00
R0769:Sis UTSW 3 72952531 missense probably damaging 1.00
R0772:Sis UTSW 3 72952531 missense probably damaging 1.00
R0774:Sis UTSW 3 72952531 missense probably damaging 1.00
R0776:Sis UTSW 3 72952531 missense probably damaging 1.00
R0818:Sis UTSW 3 72952531 missense probably damaging 1.00
R0819:Sis UTSW 3 72952531 missense probably damaging 1.00
R0885:Sis UTSW 3 72911949 nonsense probably null
R1076:Sis UTSW 3 72934098 missense probably damaging 0.97
R1140:Sis UTSW 3 72951616 missense probably damaging 0.98
R1175:Sis UTSW 3 72958104 splice site probably benign
R1301:Sis UTSW 3 72946582 missense possibly damaging 0.76
R1437:Sis UTSW 3 72934142 missense probably damaging 1.00
R1466:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1466:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1472:Sis UTSW 3 72889027 missense probably benign 0.12
R1584:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1707:Sis UTSW 3 72909087 splice site probably benign
R1715:Sis UTSW 3 72889010 missense possibly damaging 0.47
R1719:Sis UTSW 3 72965604 missense probably damaging 1.00
R1728:Sis UTSW 3 72965645 nonsense probably null
R1784:Sis UTSW 3 72965645 nonsense probably null
R1820:Sis UTSW 3 72921142 missense probably damaging 1.00
R1972:Sis UTSW 3 72921004 missense probably damaging 1.00
R1973:Sis UTSW 3 72921004 missense probably damaging 1.00
R2054:Sis UTSW 3 72913237 missense probably benign 0.01
R2233:Sis UTSW 3 72913194 missense probably benign 0.03
R2235:Sis UTSW 3 72913194 missense probably benign 0.03
R2276:Sis UTSW 3 72914601 nonsense probably null
R2435:Sis UTSW 3 72911904 missense probably benign 0.01
R2885:Sis UTSW 3 72909173 missense probably benign 0.01
R2966:Sis UTSW 3 72889010 missense probably benign 0.30
R3708:Sis UTSW 3 72943523 missense probably benign 0.02
R3790:Sis UTSW 3 72921414 missense probably damaging 1.00
R3807:Sis UTSW 3 72925596 missense probably benign 0.01
R3858:Sis UTSW 3 72928652 missense probably damaging 0.99
R3974:Sis UTSW 3 72943635 missense probably damaging 0.96
R3975:Sis UTSW 3 72943635 missense probably damaging 0.96
R4037:Sis UTSW 3 72928602 missense probably benign
R4080:Sis UTSW 3 72921184 missense probably damaging 1.00
R4204:Sis UTSW 3 72961082 missense probably benign
R4394:Sis UTSW 3 72956149 missense probably damaging 1.00
R4470:Sis UTSW 3 72928159 splice site probably null
R4573:Sis UTSW 3 72928237 missense possibly damaging 0.94
R4868:Sis UTSW 3 72943548 missense probably benign 0.09
R5023:Sis UTSW 3 72934122 missense probably benign 0.05
R5264:Sis UTSW 3 72949756 missense probably damaging 0.98
R5414:Sis UTSW 3 72952493 missense probably benign
R5462:Sis UTSW 3 72949838 missense probably damaging 0.96
R5523:Sis UTSW 3 72891421 missense probably benign 0.00
R5584:Sis UTSW 3 72910415 missense probably damaging 1.00
R5587:Sis UTSW 3 72914576 missense possibly damaging 0.94
R5725:Sis UTSW 3 72965598 missense probably damaging 1.00
R5769:Sis UTSW 3 72928235 missense probably damaging 0.98
R5790:Sis UTSW 3 72928174 missense probably benign
R5864:Sis UTSW 3 72949818 missense probably damaging 1.00
R5925:Sis UTSW 3 72921380 synonymous probably null
R6018:Sis UTSW 3 72913192 missense possibly damaging 0.95
R6029:Sis UTSW 3 72928308 missense probably benign 0.30
R6124:Sis UTSW 3 72953211 missense possibly damaging 0.69
R6171:Sis UTSW 3 72961027 missense possibly damaging 0.75
R6182:Sis UTSW 3 72904293 missense probably benign 0.05
R6295:Sis UTSW 3 72966770 missense probably damaging 0.99
R6416:Sis UTSW 3 72911854 missense probably damaging 1.00
R6431:Sis UTSW 3 72958174 missense probably benign 0.00
R6472:Sis UTSW 3 72938734 nonsense probably null
R6517:Sis UTSW 3 72907142 missense probably damaging 1.00
R6701:Sis UTSW 3 72949527 missense probably damaging 1.00
R6796:Sis UTSW 3 72965618 missense probably benign 0.06
R6853:Sis UTSW 3 72891426 missense possibly damaging 0.93
R6906:Sis UTSW 3 72919485 missense probably damaging 1.00
R7058:Sis UTSW 3 72903607 missense probably damaging 0.98
R7357:Sis UTSW 3 72925071 missense probably damaging 1.00
R7439:Sis UTSW 3 72909041 missense possibly damaging 0.81
X0009:Sis UTSW 3 72889022 missense probably damaging 0.99
X0024:Sis UTSW 3 72928670 missense probably benign
X0060:Sis UTSW 3 72920906 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCTGAGGGTGGACAATATACTGG -3'
(R):5'- TCAGCGTGTCATTTGTAGCAG -3'

Sequencing Primer
(F):5'- CAGAGGACCTGGGTTCAGTTCTC -3'
(R):5'- CACTGAGCAGAATCCCTT -3'
Posted On2017-02-15