Incidental Mutation 'R5902:Rasgrf2'
ID456405
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene NameRAS protein-specific guanine nucleotide-releasing factor 2
SynonymsGrf2, 6330417G04Rik
MMRRC Submission 044100-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R5902 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location91880400-92131656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91919892 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 260 (I260K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326]
Predicted Effect probably damaging
Transcript: ENSMUST00000099326
AA Change: I861K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: I861K

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151408
AA Change: I260K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: I260K

DomainStartEndE-ValueType
RasGEFN 33 175 9.35e-15 SMART
RasGEFN 186 323 6.04e-9 SMART
RasGEF 349 586 2.97e-112 SMART
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.1%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,708,937 M1V probably null Het
Abca13 T A 11: 9,297,177 L2308H probably damaging Het
Abcc8 T C 7: 46,115,039 T1161A probably benign Het
Acin1 T A 14: 54,663,673 T659S probably benign Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Alkbh8 A G 9: 3,385,414 K569E probably benign Het
Anxa3 A T 5: 96,812,853 K39* probably null Het
Aoc2 A G 11: 101,329,246 E659G probably damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
AU022252 T C 4: 119,226,904 D104G probably benign Het
Car6 T C 4: 150,187,499 Y231C possibly damaging Het
Ccdc94 A G 17: 55,962,077 T62A probably damaging Het
Cdh10 T G 15: 18,985,255 probably null Het
Cebpz A C 17: 78,925,937 M787R probably benign Het
Chst2 A G 9: 95,405,609 L228P probably damaging Het
Clic4 T C 4: 135,272,558 K11R probably benign Het
Col6a3 C T 1: 90,802,199 probably null Het
Commd7 T A 2: 153,621,817 T144S probably damaging Het
Ctla2a T A 13: 60,935,020 *138Y probably null Het
Dhx33 A T 11: 70,989,131 V351D probably damaging Het
Dnah9 G A 11: 66,025,187 T2313I probably benign Het
Dspp A T 5: 104,178,111 D780V unknown Het
Dync1li1 A G 9: 114,717,861 probably null Het
E2f3 C T 13: 29,985,267 probably benign Het
Fan1 T C 7: 64,373,322 probably null Het
Gart A G 16: 91,628,527 S617P probably damaging Het
Ggcx A G 6: 72,429,996 N705S possibly damaging Het
Gm4841 A T 18: 60,270,796 V75E probably damaging Het
Greb1l A G 18: 10,538,302 E1105G probably benign Het
Hr C A 14: 70,557,791 Q288K probably benign Het
Hus1 T C 11: 9,010,669 probably benign Het
Ifi47 C A 11: 49,095,386 probably null Het
Irf2bp1 T C 7: 19,004,447 V4A probably benign Het
Kprp C T 3: 92,824,528 C405Y unknown Het
Lacc1 T C 14: 77,034,799 I186V possibly damaging Het
Lifr A G 15: 7,190,750 T954A probably benign Het
Lonrf2 T C 1: 38,807,093 M333V probably benign Het
Mthfd1 A T 12: 76,291,052 H400L probably benign Het
Myh4 A G 11: 67,250,907 K864R possibly damaging Het
Nup50 C T 15: 84,935,440 A305V probably benign Het
Olfr1247 T A 2: 89,609,251 I284L probably damaging Het
Olfr1294 C T 2: 111,537,394 M298I probably benign Het
Pax4 G T 6: 28,447,127 Q3K probably benign Het
Pced1b T G 15: 97,385,089 Y336* probably null Het
Postn C A 3: 54,372,089 N329K probably benign Het
Prickle1 T C 15: 93,510,672 E82G probably null Het
Prtn3 T C 10: 79,882,932 Y241H probably damaging Het
Sh3glb1 T C 3: 144,712,670 N44S possibly damaging Het
Sis A T 3: 72,960,256 probably null Het
Slc4a9 A G 18: 36,529,333 probably null Het
Slc4a9 A T 18: 36,531,507 D406V probably damaging Het
Slc8a1 C T 17: 81,408,082 G841R probably damaging Het
Smn1 C T 13: 100,126,904 P60L probably benign Het
Snai1 G A 2: 167,542,010 C241Y probably damaging Het
Spock3 A G 8: 63,355,302 D411G unknown Het
Szt2 T A 4: 118,391,503 T607S probably benign Het
Tcap A T 11: 98,383,847 M1L probably benign Het
Tex29 C A 8: 11,854,276 probably benign Het
Tex29 C T 8: 11,854,277 probably benign Het
Tex29 A T 8: 11,855,723 probably benign Het
Tln2 T C 9: 67,362,717 T467A probably benign Het
Trim34a C T 7: 104,261,121 Q377* probably null Het
Ube2q1 T A 3: 89,776,180 L144* probably null Het
Vps13c A G 9: 67,934,447 E1917G probably benign Het
Wdr19 T A 5: 65,227,139 N525K probably benign Het
Wdr3 A T 3: 100,144,491 probably benign Het
Wnt5b T A 6: 119,448,238 H6L probably benign Het
Zdbf2 T C 1: 63,306,526 S1355P possibly damaging Het
Zfp11 T A 5: 129,657,912 I162F probably damaging Het
Zpbp T C 11: 11,415,332 T172A probably benign Het
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92022917 splice site probably benign
IGL01358:Rasgrf2 APN 13 91982630 missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92038210 missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 91982738 missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 91988026 missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92131392 missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92030765 missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 91983633 missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92022905 missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 91987979 missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 91896051 missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 91919817 splice site probably benign
R0632:Rasgrf2 UTSW 13 91972274 missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 91982771 missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92028666 missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 91887689 missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92030888 missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 91983676 missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 91896086 missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 91890664 missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 91902621 missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 91969030 missense probably benign
R1934:Rasgrf2 UTSW 13 91983706 splice site probably null
R1990:Rasgrf2 UTSW 13 92035965 missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 91902629 missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92030843 missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 91972255 missense probably benign
R2193:Rasgrf2 UTSW 13 92023713 splice site probably null
R2406:Rasgrf2 UTSW 13 91972240 missense probably benign
R3055:Rasgrf2 UTSW 13 92029075 missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92030788 missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3956:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R4133:Rasgrf2 UTSW 13 91982654 missense possibly damaging 0.59
R4177:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4357:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4439:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4440:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4564:Rasgrf2 UTSW 13 91885654 nonsense probably null
R4576:Rasgrf2 UTSW 13 91896410 missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92038281 missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 91990830 critical splice donor site probably null
R4778:Rasgrf2 UTSW 13 91983661 missense probably damaging 0.99
R4790:Rasgrf2 UTSW 13 91988016 missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92023682 missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 91896036 missense probably damaging 1.00
R5286:Rasgrf2 UTSW 13 92131433 missense possibly damaging 0.94
R6180:Rasgrf2 UTSW 13 92029101 missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92030785 missense probably damaging 1.00
R6369:Rasgrf2 UTSW 13 92131446 missense probably benign
R6428:Rasgrf2 UTSW 13 91987981 missense probably damaging 1.00
R6595:Rasgrf2 UTSW 13 92030853 missense probably damaging 1.00
R6619:Rasgrf2 UTSW 13 92028519 missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 91885635 missense probably benign 0.02
R7026:Rasgrf2 UTSW 13 91983613 missense probably damaging 1.00
R7038:Rasgrf2 UTSW 13 91982833 missense possibly damaging 0.95
R7045:Rasgrf2 UTSW 13 92022592 intron probably benign
R7056:Rasgrf2 UTSW 13 92030695 missense probably damaging 0.99
R7058:Rasgrf2 UTSW 13 91886402 missense probably damaging 0.99
R7256:Rasgrf2 UTSW 13 91884518 nonsense probably null
R7392:Rasgrf2 UTSW 13 91893737 missense
R7469:Rasgrf2 UTSW 13 92029022 critical splice donor site probably null
X0013:Rasgrf2 UTSW 13 92030855 missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 91902535 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGACAGCAATGTTGGCCAC -3'
(R):5'- AAGCAGAATTCACAGGTCTGAAAC -3'

Sequencing Primer
(F):5'- AGCTTCTAAATCCCAAGGCTTC -3'
(R):5'- GGTCTGAAACCTTTTTCCCTCC -3'
Posted On2017-02-15