Incidental Mutation 'R6111:Wdr72'
ID484850
Institutional Source Beutler Lab
Gene Symbol Wdr72
Ensembl Gene ENSMUSG00000044976
Gene NameWD repeat domain 72
Synonyms
MMRRC Submission 044260-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R6111 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location74110356-74283308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74210325 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 773 (M773T)
Ref Sequence ENSEMBL: ENSMUSP00000149349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055879] [ENSMUST00000215440]
Predicted Effect probably benign
Transcript: ENSMUST00000055879
AA Change: M785T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057320
Gene: ENSMUSG00000044976
AA Change: M785T

DomainStartEndE-ValueType
WD40 4 45 1.24e0 SMART
WD40 51 93 1.54e0 SMART
WD40 143 188 8.22e1 SMART
Blast:WD40 319 363 4e-19 BLAST
WD40 398 443 8.88e0 SMART
WD40 461 506 5.97e-1 SMART
WD40 509 554 9.9e0 SMART
WD40 557 596 2.12e-3 SMART
low complexity region 694 711 N/A INTRINSIC
low complexity region 780 798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215440
AA Change: M773T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with eight WD-40 repeats. Mutations in this gene have been associated with amelogenesis imperfecta hypomaturation type 2A3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele display hypomineralized enamel, ameloblast abnormalities and decreased post-weaning body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T C 14: 32,806,798 I40T possibly damaging Het
2210408I21Rik A G 13: 77,327,902 E1110G possibly damaging Het
Abcd4 G A 12: 84,615,114 T79I probably damaging Het
Acd A G 8: 105,698,287 M407T probably benign Het
Adcy2 T A 13: 68,729,241 H460L probably damaging Het
Arntl2 T C 6: 146,820,599 F223L probably benign Het
Atad2 G A 15: 58,108,091 H752Y probably benign Het
Camsap2 A G 1: 136,281,298 S819P probably benign Het
Col24a1 C A 3: 145,314,054 T62K probably damaging Het
Cpne6 G A 14: 55,514,634 V283M probably benign Het
D630003M21Rik A G 2: 158,213,448 S590P probably damaging Het
Daam1 T A 12: 71,942,264 M146K unknown Het
Dclk2 A G 3: 86,805,661 Y495H probably benign Het
Ddx4 A T 13: 112,621,232 C330* probably null Het
Dlec1 T C 9: 119,102,624 L37P possibly damaging Het
Dock2 G A 11: 34,708,787 P322S probably damaging Het
Espl1 A G 15: 102,299,888 E443G probably damaging Het
Eya4 T A 10: 23,140,055 D338V possibly damaging Het
Fcmr A G 1: 130,877,829 I267V probably damaging Het
Gfra3 T A 18: 34,690,874 H349L probably damaging Het
Gm25747 A G 12: 113,429,083 probably benign Het
Gria4 G A 9: 4,502,430 R368C probably damaging Het
H2-Q5 A T 17: 35,394,909 I145F possibly damaging Het
Hace1 A T 10: 45,589,510 K54I possibly damaging Het
Ift122 T A 6: 115,875,286 I79N probably damaging Het
Ino80b A G 6: 83,124,366 V121A probably damaging Het
Kcnq1 A G 7: 143,107,737 T63A probably benign Het
Map4k4 C A 1: 40,011,662 Q762K probably benign Het
Mios G A 6: 8,214,836 A11T probably benign Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Notch2 T C 3: 98,146,293 S2091P probably benign Het
Nudt19 T A 7: 35,555,527 D93V probably benign Het
Olfr875 T C 9: 37,772,932 I91T probably damaging Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
P3h1 C T 4: 119,241,132 R369* probably null Het
Pcdhb3 A T 18: 37,302,189 I403L probably benign Het
Pigo T C 4: 43,019,724 D935G probably benign Het
Plpp1 A G 13: 112,866,917 H224R probably damaging Het
Rai1 T A 11: 60,187,906 M932K probably damaging Het
Rexo2 A T 9: 48,473,112 F122L probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sdc3 A G 4: 130,818,842 T77A unknown Het
Skint5 T C 4: 113,705,648 T786A unknown Het
Smok3c C A 5: 138,065,103 P284Q probably damaging Het
Spg11 A G 2: 122,093,482 V786A probably damaging Het
Tnfrsf10b T A 14: 69,782,558 C380S possibly damaging Het
Tsen54 T C 11: 115,820,130 V176A possibly damaging Het
Ttll4 A T 1: 74,697,539 K1141M possibly damaging Het
Ttpa A T 4: 20,014,772 I116F probably damaging Het
Tubgcp6 T C 15: 89,100,920 D1655G possibly damaging Het
Usp38 A G 8: 81,013,922 V172A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Xirp2 T A 2: 67,511,817 H1467Q possibly damaging Het
Zdhhc8 G T 16: 18,224,898 S479R probably damaging Het
Zfp423 A G 8: 87,782,687 V322A probably damaging Het
Zfp72 T G 13: 74,372,385 E191D probably benign Het
Zfp933 T C 4: 147,828,760 T14A probably damaging Het
Other mutations in Wdr72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Wdr72 APN 9 74155129 missense probably damaging 1.00
IGL01385:Wdr72 APN 9 74179506 splice site probably benign
IGL01512:Wdr72 APN 9 74148759 missense probably benign 0.02
IGL01544:Wdr72 APN 9 74148725 missense probably damaging 1.00
IGL01938:Wdr72 APN 9 74148774 missense probably benign 0.25
IGL02090:Wdr72 APN 9 74154930 missense possibly damaging 0.87
IGL02121:Wdr72 APN 9 74281729 utr 3 prime probably benign
IGL02140:Wdr72 APN 9 74210223 missense probably benign 0.40
IGL02171:Wdr72 APN 9 74210534 missense possibly damaging 0.94
IGL02208:Wdr72 APN 9 74157299 missense probably damaging 1.00
IGL02936:Wdr72 APN 9 74152580 missense probably damaging 1.00
IGL02979:Wdr72 APN 9 74179556 missense probably damaging 1.00
IGL03263:Wdr72 APN 9 74157429 missense probably damaging 1.00
Arresting UTSW 9 74179501 splice site probably benign
R2036_Wdr72_658 UTSW 9 74151594 missense probably damaging 1.00
F5770:Wdr72 UTSW 9 74157270 missense probably damaging 0.96
R0107:Wdr72 UTSW 9 74210433 missense probably damaging 1.00
R0332:Wdr72 UTSW 9 74157252 critical splice acceptor site probably null
R0420:Wdr72 UTSW 9 74210757 missense possibly damaging 0.75
R0536:Wdr72 UTSW 9 74157408 missense probably damaging 1.00
R0565:Wdr72 UTSW 9 74217306 missense probably benign 0.34
R0755:Wdr72 UTSW 9 74145094 missense probably benign 0.05
R1183:Wdr72 UTSW 9 74179585 missense probably benign 0.00
R1636:Wdr72 UTSW 9 74179625 missense probably benign 0.00
R1668:Wdr72 UTSW 9 74210162 missense probably damaging 0.99
R1687:Wdr72 UTSW 9 74210199 missense probably benign 0.13
R1813:Wdr72 UTSW 9 74276016 missense possibly damaging 0.85
R1835:Wdr72 UTSW 9 74151617 missense probably damaging 1.00
R2036:Wdr72 UTSW 9 74151594 missense probably damaging 1.00
R2113:Wdr72 UTSW 9 74145172 missense probably benign 0.07
R2331:Wdr72 UTSW 9 74148326 missense probably damaging 1.00
R2369:Wdr72 UTSW 9 74210175 missense possibly damaging 0.77
R3973:Wdr72 UTSW 9 74218697 missense probably benign
R4021:Wdr72 UTSW 9 74151593 missense probably benign 0.18
R4596:Wdr72 UTSW 9 74151605 missense probably benign 0.00
R4665:Wdr72 UTSW 9 74210024 missense probably benign 0.10
R4694:Wdr72 UTSW 9 74179555 missense probably damaging 1.00
R4894:Wdr72 UTSW 9 74210561 missense probably benign 0.00
R5027:Wdr72 UTSW 9 74145976 missense probably damaging 1.00
R5269:Wdr72 UTSW 9 74157371 missense probably damaging 1.00
R5432:Wdr72 UTSW 9 74275946 missense probably damaging 1.00
R5470:Wdr72 UTSW 9 74139699 nonsense probably null
R5717:Wdr72 UTSW 9 74148205 missense probably damaging 1.00
R5793:Wdr72 UTSW 9 74210343 missense probably benign 0.02
R5963:Wdr72 UTSW 9 74145028 missense probably damaging 1.00
R6108:Wdr72 UTSW 9 74151668 missense probably damaging 0.97
R6113:Wdr72 UTSW 9 74152641 missense probably benign 0.02
R6245:Wdr72 UTSW 9 74148223 missense probably damaging 1.00
R6469:Wdr72 UTSW 9 74213361 missense probably benign 0.15
R6726:Wdr72 UTSW 9 74152540 missense possibly damaging 0.54
R6857:Wdr72 UTSW 9 74155041 missense probably damaging 1.00
R6916:Wdr72 UTSW 9 74155039 missense probably benign
R6921:Wdr72 UTSW 9 74210646 missense probably benign
R7092:Wdr72 UTSW 9 74210472 missense probably damaging 1.00
R7104:Wdr72 UTSW 9 74148315 missense probably damaging 1.00
R7560:Wdr72 UTSW 9 74210126 missense probably damaging 1.00
R7684:Wdr72 UTSW 9 74147010 missense probably damaging 1.00
R8025:Wdr72 UTSW 9 74143499 missense probably benign 0.00
R8035:Wdr72 UTSW 9 74179501 splice site probably benign
R8079:Wdr72 UTSW 9 74218772 missense probably damaging 0.99
R8142:Wdr72 UTSW 9 74139667 missense probably damaging 1.00
R8166:Wdr72 UTSW 9 74213328 missense probably benign
R8266:Wdr72 UTSW 9 74143492 missense probably damaging 1.00
R8465:Wdr72 UTSW 9 74152448 missense possibly damaging 0.93
V7583:Wdr72 UTSW 9 74157270 missense probably damaging 0.96
X0067:Wdr72 UTSW 9 74152502 missense probably damaging 1.00
Z1177:Wdr72 UTSW 9 74210536 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTCATTCTATGGAGGTGAC -3'
(R):5'- GGTCTTCATTCGAGGCAAGTC -3'

Sequencing Primer
(F):5'- GTGACATCTTGAGGAGAGCC -3'
(R):5'- TTCATTCGAGGCAAGTCCCAAAG -3'
Posted On2017-08-16