Mutagenetix > Incidental Mutation

Incidental Mutation 'R6111:Nfatc1'

484875

Institutional Source

Beutler Lab

Gene Symbol

Nfatc1

Ensembl Gene

ENSMUSG00000033016

Gene Name

nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1

Synonyms

NFATc, NFAT2, 2210017P03Rik, NF-ATc

MMRRC Submission

044260-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6111 (G1)

Quality Score

209.009

Status

Validated

Chromosome

Chromosomal Location

80606205-80713071 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80697910 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 278 (S278P)

Ref Sequence

ENSEMBL: ENSMUSP00000126884 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035800] [ENSMUST00000078049] [ENSMUST00000167977] [ENSMUST00000170905]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000035800
AA Change: S278P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046312
Gene: ENSMUSG00000033016
AA Change: S278P

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	156	188	N/A	INTRINSIC
low complexity region	263	279	N/A	INTRINSIC
Pfam:RHD	415	575	7.4e-28	PFAM
IPT	582	681	8.99e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000078049
AA Change: S292P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000077196
Gene: ENSMUSG00000033016
AA Change: S292P

Domain	Start	End	E-Value	Type
low complexity region	170	202	N/A	INTRINSIC
low complexity region	277	293	N/A	INTRINSIC
Pfam:RHD	429	589	1.3e-27	PFAM
IPT	596	695	8.99e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167977
AA Change: S278P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126884
Gene: ENSMUSG00000033016
AA Change: S278P

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	156	188	N/A	INTRINSIC
low complexity region	263	279	N/A	INTRINSIC
Pfam:RHD	415	575	4.9e-28	PFAM
IPT	582	681	8.99e-21	SMART
low complexity region	832	841	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000170905
AA Change: S292P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000129001
Gene: ENSMUSG00000033016
AA Change: S292P

Domain	Start	End	E-Value	Type
low complexity region	170	202	N/A	INTRINSIC
low complexity region	277	293	N/A	INTRINSIC
Pfam:RHD_DNA_bind	429	589	5.1e-28	PFAM
IPT	596	695	8.99e-21	SMART
low complexity region	846	855	N/A	INTRINSIC

Meta Mutation Damage Score

0.1501

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear factor of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation, and an inducible nuclear component. Proteins belonging to this family of transcription factors play a central role in inducible gene transcription during immune response. The product of this gene is an inducible nuclear component. It functions as a major molecular target for the immunosuppressive drugs such as cyclosporin A. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Different isoforms of this protein may regulate inducible expression of different cytokine genes. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality throughout fetal growth and development due to cardiac failure. Mutants exhibit blood circulation, cardiac valve and ventricular septal abnormalities, edema, abdominal hemorrhage, and semilunar valveregurgitation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810011H11Rik	T	C	14: 32,806,798	I40T	possibly damaging	Het
2210408I21Rik	A	G	13: 77,327,902	E1110G	possibly damaging	Het
Abcd4	G	A	12: 84,615,114	T79I	probably damaging	Het
Acd	A	G	8: 105,698,287	M407T	probably benign	Het
Adcy2	T	A	13: 68,729,241	H460L	probably damaging	Het
Arntl2	T	C	6: 146,820,599	F223L	probably benign	Het
Atad2	G	A	15: 58,108,091	H752Y	probably benign	Het
Camsap2	A	G	1: 136,281,298	S819P	probably benign	Het
Col24a1	C	A	3: 145,314,054	T62K	probably damaging	Het
Cpne6	G	A	14: 55,514,634	V283M	probably benign	Het
D630003M21Rik	A	G	2: 158,213,448	S590P	probably damaging	Het
Daam1	T	A	12: 71,942,264	M146K	unknown	Het
Dclk2	A	G	3: 86,805,661	Y495H	probably benign	Het
Ddx4	A	T	13: 112,621,232	C330*	probably null	Het
Dlec1	T	C	9: 119,102,624	L37P	possibly damaging	Het
Dock2	G	A	11: 34,708,787	P322S	probably damaging	Het
Espl1	A	G	15: 102,299,888	E443G	probably damaging	Het
Eya4	T	A	10: 23,140,055	D338V	possibly damaging	Het
Fcmr	A	G	1: 130,877,829	I267V	probably damaging	Het
Gfra3	T	A	18: 34,690,874	H349L	probably damaging	Het
Gm25747	A	G	12: 113,429,083		probably benign	Het
Gria4	G	A	9: 4,502,430	R368C	probably damaging	Het
H2-Q5	A	T	17: 35,394,909	I145F	possibly damaging	Het
Hace1	A	T	10: 45,589,510	K54I	possibly damaging	Het
Ift122	T	A	6: 115,875,286	I79N	probably damaging	Het
Ino80b	A	G	6: 83,124,366	V121A	probably damaging	Het
Kcnq1	A	G	7: 143,107,737	T63A	probably benign	Het
Map4k4	C	A	1: 40,011,662	Q762K	probably benign	Het
Mios	G	A	6: 8,214,836	A11T	probably benign	Het
Notch2	T	C	3: 98,146,293	S2091P	probably benign	Het
Nudt19	T	A	7: 35,555,527	D93V	probably benign	Het
Olfr875	T	C	9: 37,772,932	I91T	probably damaging	Het
Osbpl2	A	G	2: 180,150,201	T233A	probably benign	Het
P3h1	C	T	4: 119,241,132	R369*	probably null	Het
Pcdhb3	A	T	18: 37,302,189	I403L	probably benign	Het
Pigo	T	C	4: 43,019,724	D935G	probably benign	Het
Plpp1	A	G	13: 112,866,917	H224R	probably damaging	Het
Rai1	T	A	11: 60,187,906	M932K	probably damaging	Het
Rexo2	A	T	9: 48,473,112	F122L	probably damaging	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Sdc3	A	G	4: 130,818,842	T77A	unknown	Het
Skint5	T	C	4: 113,705,648	T786A	unknown	Het
Smok3c	C	A	5: 138,065,103	P284Q	probably damaging	Het
Spg11	A	G	2: 122,093,482	V786A	probably damaging	Het
Tnfrsf10b	T	A	14: 69,782,558	C380S	possibly damaging	Het
Tsen54	T	C	11: 115,820,130	V176A	possibly damaging	Het
Ttll4	A	T	1: 74,697,539	K1141M	possibly damaging	Het
Ttpa	A	T	4: 20,014,772	I116F	probably damaging	Het
Tubgcp6	T	C	15: 89,100,920	D1655G	possibly damaging	Het
Usp38	A	G	8: 81,013,922	V172A	probably damaging	Het
Vmn2r73	A	G	7: 85,871,789	S324P	probably benign	Het
Wdr72	T	C	9: 74,210,325	M773T	probably benign	Het
Xirp2	T	A	2: 67,511,817	H1467Q	possibly damaging	Het
Zdhhc8	G	T	16: 18,224,898	S479R	probably damaging	Het
Zfp423	A	G	8: 87,782,687	V322A	probably damaging	Het
Zfp72	T	G	13: 74,372,385	E191D	probably benign	Het
Zfp933	T	C	4: 147,828,760	T14A	probably damaging	Het

Other mutations in Nfatc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Nfatc1	APN	18	80667026	missense	probably damaging	1.00
IGL00742:Nfatc1	APN	18	80698014	missense	probably benign	0.20
IGL01510:Nfatc1	APN	18	80698188	missense	probably damaging	1.00
IGL01790:Nfatc1	APN	18	80667042	missense	probably damaging	1.00
IGL02548:Nfatc1	APN	18	80697898	missense	probably damaging	1.00
goldfeld	UTSW	18	80697832	missense	probably damaging	0.99
Instrumenten	UTSW	18	80682191	missense	probably damaging	0.98
Original	UTSW	18	80653564	splice site	probably null
BB003:Nfatc1	UTSW	18	80697666	missense	probably damaging	0.96
BB013:Nfatc1	UTSW	18	80697666	missense	probably damaging	0.96
R0019:Nfatc1	UTSW	18	80635504	missense	probably benign
R0411:Nfatc1	UTSW	18	80698042	missense	possibly damaging	0.88
R0738:Nfatc1	UTSW	18	80697910	missense	probably damaging	1.00
R0940:Nfatc1	UTSW	18	80635895	missense	probably benign	0.03
R1458:Nfatc1	UTSW	18	80665267	splice site	probably benign
R1622:Nfatc1	UTSW	18	80666967	missense	probably damaging	1.00
R1845:Nfatc1	UTSW	18	80635531	missense	possibly damaging	0.67
R2110:Nfatc1	UTSW	18	80635664	nonsense	probably null
R2112:Nfatc1	UTSW	18	80635664	nonsense	probably null
R2157:Nfatc1	UTSW	18	80635845	missense	possibly damaging	0.88
R3857:Nfatc1	UTSW	18	80665275	splice site	probably benign
R3859:Nfatc1	UTSW	18	80665275	splice site	probably benign
R4108:Nfatc1	UTSW	18	80698368	missense	possibly damaging	0.68
R4510:Nfatc1	UTSW	18	80635579	missense	probably damaging	0.96
R4511:Nfatc1	UTSW	18	80635579	missense	probably damaging	0.96
R4618:Nfatc1	UTSW	18	80697832	missense	probably damaging	0.99
R4850:Nfatc1	UTSW	18	80697865	missense	probably benign	0.30
R5329:Nfatc1	UTSW	18	80708117	start codon destroyed	probably null
R5395:Nfatc1	UTSW	18	80636020	missense	possibly damaging	0.80
R5468:Nfatc1	UTSW	18	80649855	missense	probably benign	0.00
R5522:Nfatc1	UTSW	18	80653529	missense	probably benign	0.36
R5568:Nfatc1	UTSW	18	80649822	missense	probably benign	0.12
R6190:Nfatc1	UTSW	18	80712670	missense	probably benign	0.21
R6397:Nfatc1	UTSW	18	80635941	missense	probably damaging	1.00
R6943:Nfatc1	UTSW	18	80635555	missense	probably damaging	1.00
R6970:Nfatc1	UTSW	18	80667013	missense	probably benign	0.34
R6994:Nfatc1	UTSW	18	80653564	splice site	probably null
R7679:Nfatc1	UTSW	18	80607990	missense	probably benign
R7703:Nfatc1	UTSW	18	80682289	missense	probably damaging	1.00
R7926:Nfatc1	UTSW	18	80697666	missense	probably damaging	0.96
R8346:Nfatc1	UTSW	18	80682167	missense	probably benign	0.00
R8411:Nfatc1	UTSW	18	80667042	missense	probably damaging	1.00
R8480:Nfatc1	UTSW	18	80635644	missense	probably benign	0.15
R8669:Nfatc1	UTSW	18	80682191	missense	probably damaging	0.98
R8928:Nfatc1	UTSW	18	80697965	missense	possibly damaging	0.82
R9194:Nfatc1	UTSW	18	80708043	missense	probably benign	0.04
R9281:Nfatc1	UTSW	18	80697975	missense	probably damaging	1.00
R9517:Nfatc1	UTSW	18	80682191	missense	probably damaging	0.98
R9562:Nfatc1	UTSW	18	80635701	missense	probably damaging	1.00
R9636:Nfatc1	UTSW	18	80663396	missense	possibly damaging	0.50
X0062:Nfatc1	UTSW	18	80697618	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- CTACTTTGAGGGCCACAGAG -3'
(R):5'- AGCTGTAACTCTGAGGCCTC -3'

Sequencing Primer
(F):5'- GGGCGCATGCTCCAGTG -3'
(R):5'- TTTTCCCCGAAGCCTGGGTG -3'

Posted On

2017-08-16