Incidental Mutation 'R6111:Usp38'
ID484844
Institutional Source Beutler Lab
Gene Symbol Usp38
Ensembl Gene ENSMUSG00000038250
Gene Nameubiquitin specific peptidase 38
Synonyms4833420O05Rik, 4631402N15Rik
MMRRC Submission 044260-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6111 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location80980733-81014928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81013922 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 172 (V172A)
Ref Sequence ENSEMBL: ENSMUSP00000039943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042724]
Predicted Effect probably damaging
Transcript: ENSMUST00000042724
AA Change: V172A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039943
Gene: ENSMUSG00000038250
AA Change: V172A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 1 365 5e-3 SMART
Pfam:UCH 444 946 1.8e-47 PFAM
Pfam:UCH_1 445 921 2.2e-23 PFAM
low complexity region 995 1006 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211538
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik T C 14: 32,806,798 I40T possibly damaging Het
2210408I21Rik A G 13: 77,327,902 E1110G possibly damaging Het
Abcd4 G A 12: 84,615,114 T79I probably damaging Het
Acd A G 8: 105,698,287 M407T probably benign Het
Adcy2 T A 13: 68,729,241 H460L probably damaging Het
Arntl2 T C 6: 146,820,599 F223L probably benign Het
Atad2 G A 15: 58,108,091 H752Y probably benign Het
Camsap2 A G 1: 136,281,298 S819P probably benign Het
Col24a1 C A 3: 145,314,054 T62K probably damaging Het
Cpne6 G A 14: 55,514,634 V283M probably benign Het
D630003M21Rik A G 2: 158,213,448 S590P probably damaging Het
Daam1 T A 12: 71,942,264 M146K unknown Het
Dclk2 A G 3: 86,805,661 Y495H probably benign Het
Ddx4 A T 13: 112,621,232 C330* probably null Het
Dlec1 T C 9: 119,102,624 L37P possibly damaging Het
Dock2 G A 11: 34,708,787 P322S probably damaging Het
Espl1 A G 15: 102,299,888 E443G probably damaging Het
Eya4 T A 10: 23,140,055 D338V possibly damaging Het
Fcmr A G 1: 130,877,829 I267V probably damaging Het
Gfra3 T A 18: 34,690,874 H349L probably damaging Het
Gm25747 A G 12: 113,429,083 probably benign Het
Gria4 G A 9: 4,502,430 R368C probably damaging Het
H2-Q5 A T 17: 35,394,909 I145F possibly damaging Het
Hace1 A T 10: 45,589,510 K54I possibly damaging Het
Ift122 T A 6: 115,875,286 I79N probably damaging Het
Ino80b A G 6: 83,124,366 V121A probably damaging Het
Kcnq1 A G 7: 143,107,737 T63A probably benign Het
Map4k4 C A 1: 40,011,662 Q762K probably benign Het
Mios G A 6: 8,214,836 A11T probably benign Het
Nfatc1 A G 18: 80,697,910 S278P probably damaging Het
Notch2 T C 3: 98,146,293 S2091P probably benign Het
Nudt19 T A 7: 35,555,527 D93V probably benign Het
Olfr875 T C 9: 37,772,932 I91T probably damaging Het
Osbpl2 A G 2: 180,150,201 T233A probably benign Het
P3h1 C T 4: 119,241,132 R369* probably null Het
Pcdhb3 A T 18: 37,302,189 I403L probably benign Het
Pigo T C 4: 43,019,724 D935G probably benign Het
Plpp1 A G 13: 112,866,917 H224R probably damaging Het
Rai1 T A 11: 60,187,906 M932K probably damaging Het
Rexo2 A T 9: 48,473,112 F122L probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sdc3 A G 4: 130,818,842 T77A unknown Het
Skint5 T C 4: 113,705,648 T786A unknown Het
Smok3c C A 5: 138,065,103 P284Q probably damaging Het
Spg11 A G 2: 122,093,482 V786A probably damaging Het
Tnfrsf10b T A 14: 69,782,558 C380S possibly damaging Het
Tsen54 T C 11: 115,820,130 V176A possibly damaging Het
Ttll4 A T 1: 74,697,539 K1141M possibly damaging Het
Ttpa A T 4: 20,014,772 I116F probably damaging Het
Tubgcp6 T C 15: 89,100,920 D1655G possibly damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Wdr72 T C 9: 74,210,325 M773T probably benign Het
Xirp2 T A 2: 67,511,817 H1467Q possibly damaging Het
Zdhhc8 G T 16: 18,224,898 S479R probably damaging Het
Zfp423 A G 8: 87,782,687 V322A probably damaging Het
Zfp72 T G 13: 74,372,385 E191D probably benign Het
Zfp933 T C 4: 147,828,760 T14A probably damaging Het
Other mutations in Usp38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Usp38 APN 8 81013840 missense probably damaging 0.99
IGL01373:Usp38 APN 8 80990018 missense possibly damaging 0.80
IGL02089:Usp38 APN 8 80985714 missense possibly damaging 0.48
IGL02528:Usp38 APN 8 80993235 missense probably damaging 1.00
IGL02538:Usp38 APN 8 80985558 missense probably damaging 1.00
IGL02615:Usp38 APN 8 80985151 missense probably benign 0.00
IGL03340:Usp38 APN 8 81012276 missense probably damaging 1.00
P0033:Usp38 UTSW 8 80981896 missense probably benign 0.12
R0313:Usp38 UTSW 8 80984442 nonsense probably null
R0331:Usp38 UTSW 8 80995840 missense probably benign 0.00
R0497:Usp38 UTSW 8 80984424 splice site probably benign
R0594:Usp38 UTSW 8 81005366 missense probably damaging 0.97
R0632:Usp38 UTSW 8 81014150 missense probably benign 0.03
R1355:Usp38 UTSW 8 80985033 missense possibly damaging 0.61
R1500:Usp38 UTSW 8 80995770 missense probably damaging 1.00
R1566:Usp38 UTSW 8 80984803 missense probably benign 0.00
R1880:Usp38 UTSW 8 81001066 missense probably damaging 1.00
R4161:Usp38 UTSW 8 80993338 missense probably damaging 1.00
R4176:Usp38 UTSW 8 80993299 missense probably benign 0.33
R4882:Usp38 UTSW 8 80981977 nonsense probably null
R5344:Usp38 UTSW 8 80985763 missense possibly damaging 0.76
R5481:Usp38 UTSW 8 80993323 missense possibly damaging 0.89
R5564:Usp38 UTSW 8 80985088 missense probably damaging 0.96
R5897:Usp38 UTSW 8 81005453 missense probably benign 0.03
R6746:Usp38 UTSW 8 81014291 missense possibly damaging 0.80
R6912:Usp38 UTSW 8 80993329 missense probably damaging 1.00
R7051:Usp38 UTSW 8 81001121 missense possibly damaging 0.50
R7483:Usp38 UTSW 8 81014561 start gained probably benign
R7525:Usp38 UTSW 8 81014246 missense probably damaging 1.00
R7565:Usp38 UTSW 8 80981972 missense probably damaging 1.00
R8062:Usp38 UTSW 8 80984589 missense probably damaging 1.00
RF016:Usp38 UTSW 8 81013893 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGTTGATGAGACACACGTG -3'
(R):5'- TGATTATGAGCTGCCCGTCG -3'

Sequencing Primer
(F):5'- GAGACACACGTGTTGAATTTCC -3'
(R):5'- GGTGCTGGATCTCTTCAGCC -3'
Posted On2017-08-16