Mutagenetix > Incidental Mutations

Incidental Mutation 'R6111:Atad2'

484868

Institutional Source

Beutler Lab

Gene Symbol

Atad2

Ensembl Gene

ENSMUSG00000022360

Gene Name

ATPase family, AAA domain containing 2

Synonyms

2610509G12Rik

MMRRC Submission

044260-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.346) question?

Stock #

R6111 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58094044-58135082 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 58108091 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 752 (H752Y)

Ref Sequence

ENSEMBL: ENSMUSP00000043691 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038194] [ENSMUST00000228783]

Predicted Effect

probably benign
Transcript: ENSMUST00000038194
AA Change: H752Y

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000043691
Gene: ENSMUSG00000022360
AA Change: H752Y

Domain	Start	End	E-Value	Type
low complexity region	12	35	N/A	INTRINSIC
low complexity region	36	47	N/A	INTRINSIC
low complexity region	184	199	N/A	INTRINSIC
low complexity region	237	268	N/A	INTRINSIC
low complexity region	337	349	N/A	INTRINSIC
AAA	438	579	9.93e-21	SMART
low complexity region	622	633	N/A	INTRINSIC
SCOP:d1e32a2	751	912	5e-4	SMART
low complexity region	924	947	N/A	INTRINSIC
BROMO	955	1067	1.2e-19	SMART
low complexity region	1213	1235	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226507

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226526

Predicted Effect

probably benign
Transcript: ENSMUST00000228783
AA Change: H428Y

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large family of ATPases has been described, whose key feature is that they share a conserved region of about 220 amino acids that contains an ATP-binding site. The proteins that belong to this family either contain one or two AAA (ATPases Associated with diverse cellular Activities) domains. AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes. The protein encoded by this gene contains two AAA domains, as well as a bromodomain. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810011H11Rik	T	C	14: 32,806,798	I40T	possibly damaging	Het
2210408I21Rik	A	G	13: 77,327,902	E1110G	possibly damaging	Het
Abcd4	G	A	12: 84,615,114	T79I	probably damaging	Het
Acd	A	G	8: 105,698,287	M407T	probably benign	Het
Adcy2	T	A	13: 68,729,241	H460L	probably damaging	Het
Arntl2	T	C	6: 146,820,599	F223L	probably benign	Het
Camsap2	A	G	1: 136,281,298	S819P	probably benign	Het
Col24a1	C	A	3: 145,314,054	T62K	probably damaging	Het
Cpne6	G	A	14: 55,514,634	V283M	probably benign	Het
D630003M21Rik	A	G	2: 158,213,448	S590P	probably damaging	Het
Daam1	T	A	12: 71,942,264	M146K	unknown	Het
Dclk2	A	G	3: 86,805,661	Y495H	probably benign	Het
Ddx4	A	T	13: 112,621,232	C330*	probably null	Het
Dlec1	T	C	9: 119,102,624	L37P	possibly damaging	Het
Dock2	G	A	11: 34,708,787	P322S	probably damaging	Het
Espl1	A	G	15: 102,299,888	E443G	probably damaging	Het
Eya4	T	A	10: 23,140,055	D338V	possibly damaging	Het
Fcmr	A	G	1: 130,877,829	I267V	probably damaging	Het
Gfra3	T	A	18: 34,690,874	H349L	probably damaging	Het
Gm25747	A	G	12: 113,429,083		probably benign	Het
Gria4	G	A	9: 4,502,430	R368C	probably damaging	Het
H2-Q5	A	T	17: 35,394,909	I145F	possibly damaging	Het
Hace1	A	T	10: 45,589,510	K54I	possibly damaging	Het
Ift122	T	A	6: 115,875,286	I79N	probably damaging	Het
Ino80b	A	G	6: 83,124,366	V121A	probably damaging	Het
Kcnq1	A	G	7: 143,107,737	T63A	probably benign	Het
Map4k4	C	A	1: 40,011,662	Q762K	probably benign	Het
Mios	G	A	6: 8,214,836	A11T	probably benign	Het
Nfatc1	A	G	18: 80,697,910	S278P	probably damaging	Het
Notch2	T	C	3: 98,146,293	S2091P	probably benign	Het
Nudt19	T	A	7: 35,555,527	D93V	probably benign	Het
Olfr875	T	C	9: 37,772,932	I91T	probably damaging	Het
Osbpl2	A	G	2: 180,150,201	T233A	probably benign	Het
P3h1	C	T	4: 119,241,132	R369*	probably null	Het
Pcdhb3	A	T	18: 37,302,189	I403L	probably benign	Het
Pigo	T	C	4: 43,019,724	D935G	probably benign	Het
Plpp1	A	G	13: 112,866,917	H224R	probably damaging	Het
Rai1	T	A	11: 60,187,906	M932K	probably damaging	Het
Rexo2	A	T	9: 48,473,112	F122L	probably damaging	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Sdc3	A	G	4: 130,818,842	T77A	unknown	Het
Skint5	T	C	4: 113,705,648	T786A	unknown	Het
Smok3c	C	A	5: 138,065,103	P284Q	probably damaging	Het
Spg11	A	G	2: 122,093,482	V786A	probably damaging	Het
Tnfrsf10b	T	A	14: 69,782,558	C380S	possibly damaging	Het
Tsen54	T	C	11: 115,820,130	V176A	possibly damaging	Het
Ttll4	A	T	1: 74,697,539	K1141M	possibly damaging	Het
Ttpa	A	T	4: 20,014,772	I116F	probably damaging	Het
Tubgcp6	T	C	15: 89,100,920	D1655G	possibly damaging	Het
Usp38	A	G	8: 81,013,922	V172A	probably damaging	Het
Vmn2r73	A	G	7: 85,871,789	S324P	probably benign	Het
Wdr72	T	C	9: 74,210,325	M773T	probably benign	Het
Xirp2	T	A	2: 67,511,817	H1467Q	possibly damaging	Het
Zdhhc8	G	T	16: 18,224,898	S479R	probably damaging	Het
Zfp423	A	G	8: 87,782,687	V322A	probably damaging	Het
Zfp72	T	G	13: 74,372,385	E191D	probably benign	Het
Zfp933	T	C	4: 147,828,760	T14A	probably damaging	Het

Other mutations in Atad2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Atad2	APN	15	58116820	missense	probably damaging	1.00
IGL00556:Atad2	APN	15	58100080	missense	probably damaging	1.00
IGL00674:Atad2	APN	15	58108386	missense	possibly damaging	0.49
IGL01407:Atad2	APN	15	58104525	missense	probably benign
IGL02557:Atad2	APN	15	58122597	missense	probably benign	0.04
IGL03060:Atad2	APN	15	58122446	unclassified	probably benign
IGL03308:Atad2	APN	15	58102523	missense	probably benign	0.00
R0113:Atad2	UTSW	15	58120934	unclassified	probably benign
R0195:Atad2	UTSW	15	58099954	splice site	probably benign
R0310:Atad2	UTSW	15	58114257	missense	probably damaging	1.00
R0499:Atad2	UTSW	15	58103240	missense	possibly damaging	0.92
R0499:Atad2	UTSW	15	58120949	missense	probably benign
R0564:Atad2	UTSW	15	58125833	splice site	probably benign
R0578:Atad2	UTSW	15	58105568	missense	probably damaging	1.00
R0581:Atad2	UTSW	15	58126664	missense	probably benign
R0667:Atad2	UTSW	15	58098719	missense	probably benign	0.01
R0697:Atad2	UTSW	15	58105543	missense	possibly damaging	0.91
R1219:Atad2	UTSW	15	58134911	missense	probably benign	0.00
R1271:Atad2	UTSW	15	58126589	missense	probably benign	0.00
R1544:Atad2	UTSW	15	58103364	missense	probably damaging	1.00
R1624:Atad2	UTSW	15	58100019	missense	probably damaging	1.00
R1853:Atad2	UTSW	15	58097289	missense	possibly damaging	0.56
R1854:Atad2	UTSW	15	58097289	missense	possibly damaging	0.56
R1855:Atad2	UTSW	15	58097289	missense	possibly damaging	0.56
R1860:Atad2	UTSW	15	58096718	splice site	probably null
R1861:Atad2	UTSW	15	58096718	splice site	probably null
R1876:Atad2	UTSW	15	58106868	missense	probably benign	0.00
R1938:Atad2	UTSW	15	58096705	missense	possibly damaging	0.76
R2158:Atad2	UTSW	15	58098566	missense	possibly damaging	0.95
R3756:Atad2	UTSW	15	58099723	missense	probably benign	0.01
R4256:Atad2	UTSW	15	58116856	missense	probably damaging	1.00
R4762:Atad2	UTSW	15	58108362	missense	probably benign
R4827:Atad2	UTSW	15	58108348	missense	probably benign	0.07
R4838:Atad2	UTSW	15	58103283	missense	probably damaging	1.00
R5238:Atad2	UTSW	15	58108337	missense	possibly damaging	0.90
R5247:Atad2	UTSW	15	58104478	nonsense	probably null
R5685:Atad2	UTSW	15	58116798	missense	possibly damaging	0.95
R5790:Atad2	UTSW	15	58126594	missense	probably damaging	1.00
R5813:Atad2	UTSW	15	58099854	missense	probably benign	0.42
R5886:Atad2	UTSW	15	58098514	nonsense	probably null
R5955:Atad2	UTSW	15	58105659	missense	probably benign	0.06
R6034:Atad2	UTSW	15	58108563	missense	probably damaging	1.00
R6034:Atad2	UTSW	15	58108563	missense	probably damaging	1.00
R6209:Atad2	UTSW	15	58118415	missense	probably damaging	1.00
R6587:Atad2	UTSW	15	58121048	missense	probably benign	0.03
R6856:Atad2	UTSW	15	58106813	missense	probably damaging	1.00
R7106:Atad2	UTSW	15	58116766	critical splice donor site	probably null
R7178:Atad2	UTSW	15	58117293	missense	probably damaging	1.00
R7290:Atad2	UTSW	15	58098651	missense	probably benign	0.00
R7421:Atad2	UTSW	15	58134926	missense	probably benign	0.40
R7583:Atad2	UTSW	15	58126664	missense	probably benign
R7861:Atad2	UTSW	15	58125780	missense	probably benign	0.10
R7886:Atad2	UTSW	15	58126136	missense	probably damaging	1.00
R7944:Atad2	UTSW	15	58125780	missense	probably benign	0.10
R7969:Atad2	UTSW	15	58126136	missense	probably damaging	1.00
R8072:Atad2	UTSW	15	58099978	missense	possibly damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TAGGGGCTGAACTTAGGCTTTC -3'
(R):5'- CCCTACAGAAAGTATTTCCACATGTGG -3'

Sequencing Primer
(F):5'- GGCTTTCATGTTTGTAATGAAAGC -3'
(R):5'- CTGTAGATGTTTCTTGCCC -3'

Posted On

2017-08-16