Incidental Mutation 'R6116:Wdr24'
ID485134
Institutional Source Beutler Lab
Gene Symbol Wdr24
Ensembl Gene ENSMUSG00000025737
Gene NameWD repeat domain 24
Synonyms
MMRRC Submission 044265-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6116 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25823627-25828730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25824605 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 134 (H134Y)
Ref Sequence ENSEMBL: ENSMUSP00000026833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026832] [ENSMUST00000026833] [ENSMUST00000045692] [ENSMUST00000123582] [ENSMUST00000133595]
Predicted Effect probably benign
Transcript: ENSMUST00000026832
SMART Domains Protein: ENSMUSP00000026832
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
JmjC 140 271 5.27e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026833
AA Change: H134Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026833
Gene: ENSMUSG00000025737
AA Change: H134Y

DomainStartEndE-ValueType
Blast:WD40 19 53 6e-8 BLAST
WD40 68 103 2.13e1 SMART
WD40 109 149 5.77e-5 SMART
WD40 152 192 4.48e-2 SMART
WD40 196 236 1.48e-11 SMART
WD40 244 282 1.66e0 SMART
WD40 286 327 2.48e0 SMART
low complexity region 605 623 N/A INTRINSIC
Blast:RING 743 780 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000045692
SMART Domains Protein: ENSMUSP00000048562
Gene: ENSMUSG00000025738

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
low complexity region 70 89 N/A INTRINSIC
Blast:FBOX 98 137 2e-14 BLAST
LRR 241 266 1.32e1 SMART
LRR 267 291 1.61e2 SMART
LRR 293 318 1.76e2 SMART
LRR 319 344 3.21e-4 SMART
LRR 345 370 7.67e-2 SMART
LRR 371 396 6.13e-1 SMART
LRR 421 446 3.52e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123582
SMART Domains Protein: ENSMUSP00000119840
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
low complexity region 158 172 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123692
Predicted Effect probably benign
Transcript: ENSMUST00000133595
SMART Domains Protein: ENSMUSP00000122744
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
transmembrane domain 55 74 N/A INTRINSIC
JmjC 185 316 5.27e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144589
Predicted Effect probably benign
Transcript: ENSMUST00000152434
SMART Domains Protein: ENSMUSP00000119378
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T A 19: 9,012,963 probably benign Het
Apc A T 18: 34,316,455 I2101F probably damaging Het
Bpifa3 G A 2: 154,133,713 V68I possibly damaging Het
Csmd1 T A 8: 16,211,850 I878F probably damaging Het
Cyp2c67 A T 19: 39,617,435 M339K probably damaging Het
Dock3 A G 9: 106,931,962 Y1321H probably damaging Het
Dsc1 G T 18: 20,097,299 D316E probably benign Het
Eno3 C T 11: 70,661,575 T351M possibly damaging Het
Erbb2 T A 11: 98,427,399 F487Y probably damaging Het
Exosc10 T C 4: 148,573,353 L652P probably benign Het
Glmn A T 5: 107,557,340 M470K probably damaging Het
Gm15446 T A 5: 109,943,036 C385S probably damaging Het
Gm597 G A 1: 28,778,699 A84V probably benign Het
Hspa8 A G 9: 40,804,975 E581G probably damaging Het
Igfn1 T C 1: 135,970,467 D787G probably benign Het
Igkv12-44 T C 6: 69,814,854 T42A possibly damaging Het
Itsn2 T C 12: 4,629,939 probably benign Het
Jade2 T C 11: 51,835,633 E84G probably damaging Het
Lpar3 T A 3: 146,240,597 M10K possibly damaging Het
Lpin2 A G 17: 71,243,930 D695G probably damaging Het
Mosmo T A 7: 120,726,195 L7H probably damaging Het
Ms4a8a C T 19: 11,081,072 A9T unknown Het
Myb T C 10: 21,154,754 D48G probably damaging Het
Neurod6 T C 6: 55,678,791 Y287C probably damaging Het
Olfr878 A G 9: 37,918,659 M1V probably null Het
Olfr96 A G 17: 37,225,568 T148A probably benign Het
Olr1 T A 6: 129,499,984 D106V probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Ppfia3 T C 7: 45,354,703 Y505C probably damaging Het
Sdk2 T A 11: 113,854,364 I702F probably damaging Het
Slc16a11 T C 11: 70,215,436 F119L probably benign Het
Slc2a10 A C 2: 165,517,703 T496P probably damaging Het
Slc7a2 T C 8: 40,900,169 Y181H probably damaging Het
Stab2 G T 10: 86,907,190 P1185Q probably damaging Het
Tcf7l2 T A 19: 55,919,014 S335R probably damaging Het
Ttc41 G A 10: 86,759,088 probably null Het
Vmn2r32 A T 7: 7,464,093 I812N probably damaging Het
Other mutations in Wdr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Wdr24 APN 17 25826621 missense probably benign 0.20
IGL01700:Wdr24 APN 17 25825828 missense probably damaging 1.00
IGL01763:Wdr24 APN 17 25826190 missense probably benign 0.20
IGL02567:Wdr24 APN 17 25824348 missense probably damaging 0.99
IGL03100:Wdr24 APN 17 25825707 missense possibly damaging 0.47
R0012:Wdr24 UTSW 17 25827113 missense probably benign
R0799:Wdr24 UTSW 17 25826128 missense probably damaging 1.00
R1015:Wdr24 UTSW 17 25828238 missense probably benign 0.12
R1276:Wdr24 UTSW 17 25827467 missense probably benign 0.02
R1297:Wdr24 UTSW 17 25827348 missense possibly damaging 0.90
R1934:Wdr24 UTSW 17 25824266 missense possibly damaging 0.89
R2030:Wdr24 UTSW 17 25826043 missense probably benign 0.38
R2069:Wdr24 UTSW 17 25826282 missense probably damaging 1.00
R2508:Wdr24 UTSW 17 25824299 missense possibly damaging 0.52
R4601:Wdr24 UTSW 17 25828207 unclassified probably null
R4604:Wdr24 UTSW 17 25828505 missense probably damaging 1.00
R4894:Wdr24 UTSW 17 25826127 missense probably damaging 1.00
R5068:Wdr24 UTSW 17 25825779 missense possibly damaging 0.77
R5088:Wdr24 UTSW 17 25828207 unclassified probably null
R5104:Wdr24 UTSW 17 25824591 missense probably damaging 1.00
R5498:Wdr24 UTSW 17 25824561 missense probably damaging 1.00
R5719:Wdr24 UTSW 17 25828340 critical splice donor site probably null
R5892:Wdr24 UTSW 17 25827986 missense probably benign 0.00
R5975:Wdr24 UTSW 17 25827128 missense probably benign 0.37
R6084:Wdr24 UTSW 17 25824530 missense probably damaging 0.99
R6106:Wdr24 UTSW 17 25824605 missense probably benign
R6114:Wdr24 UTSW 17 25824605 missense probably benign
R6165:Wdr24 UTSW 17 25826421 missense probably benign 0.18
R6175:Wdr24 UTSW 17 25826578 missense probably damaging 1.00
R6331:Wdr24 UTSW 17 25825676 missense possibly damaging 0.61
R6548:Wdr24 UTSW 17 25827925 missense probably damaging 0.99
R6984:Wdr24 UTSW 17 25828235 missense possibly damaging 0.93
R7485:Wdr24 UTSW 17 25826127 missense probably damaging 1.00
R7583:Wdr24 UTSW 17 25825830 missense probably null 1.00
R7770:Wdr24 UTSW 17 25827096 missense probably benign 0.04
R8086:Wdr24 UTSW 17 25826127 missense probably damaging 1.00
X0022:Wdr24 UTSW 17 25824272 missense probably damaging 0.99
Z1177:Wdr24 UTSW 17 25825687 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CATTGAGGAGGAGCAGTTCG -3'
(R):5'- GCCTCTGATGGACACACATTTC -3'

Sequencing Primer
(F):5'- CTCAACCTGAGCTGTGCTGATG -3'
(R):5'- TGATGGACACACATTTCAGCCTG -3'
Posted On2017-08-16