Incidental Mutation 'R5419:Hey2'
ID427936
Institutional Source Beutler Lab
Gene Symbol Hey2
Ensembl Gene ENSMUSG00000019789
Gene Namehairy/enhancer-of-split related with YRPW motif 2
SynonymsbHLHb32, Hesr2, CHF1, Herp1, Hrt2
MMRRC Submission 042987-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R5419 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location30832359-30842801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30834023 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 245 (T245S)
Ref Sequence ENSEMBL: ENSMUSP00000019924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019924]
Predicted Effect probably benign
Transcript: ENSMUST00000019924
AA Change: T245S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019924
Gene: ENSMUSG00000019789
AA Change: T245S

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
HLH 54 109 6.71e-16 SMART
ORANGE 119 166 5.55e-18 SMART
low complexity region 174 193 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 293 317 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hairy and enhancer of split-related (HESR) family of basic helix-loop-helix (bHLH)-type transcription factors. The encoded protein forms homo- or hetero-dimers that localize to the nucleus and interact with a histone deacetylase complex to repress transcription. Expression of this gene is induced by the Notch signal transduction pathway. Two similar and redundant genes in mouse are required for embryonic cardiovascular development, and are also implicated in neurogenesis and somitogenesis. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac hypertrophy, ventricular septal defects, pulmonary and liver congestion, and reduced preweaning viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,272,090 L926* probably null Het
4931429L15Rik C T 9: 46,309,326 probably null Het
Abca13 T A 11: 9,193,533 probably null Het
AI481877 A T 4: 59,049,017 M1116K probably benign Het
Akap13 A T 7: 75,610,243 T69S probably benign Het
Arl1 T A 10: 88,737,104 C80S probably damaging Het
Brsk1 A G 7: 4,709,004 T618A possibly damaging Het
Cep295 T C 9: 15,324,237 H1982R probably damaging Het
Ces5a A T 8: 93,499,431 S559T unknown Het
Clcf1 A G 19: 4,222,159 N90S possibly damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Cobll1 A T 2: 65,103,357 D430E possibly damaging Het
Cyp1a2 T A 9: 57,682,511 I7F probably benign Het
Cyp2b23 G A 7: 26,681,423 R126* probably null Het
Daam2 A G 17: 49,480,754 W444R possibly damaging Het
Dcbld2 T A 16: 58,455,258 C446S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eif2d T C 1: 131,158,298 *177R probably null Het
Fkbp15 G A 4: 62,327,877 A438V probably damaging Het
Gjb5 G A 4: 127,355,859 A164V probably benign Het
Gm17727 T A 9: 35,778,111 probably null Het
Gm5724 C T 6: 141,736,100 probably null Het
Grin1 A T 2: 25,298,273 probably null Het
Grm3 A G 5: 9,570,233 F337S probably damaging Het
Ifi206 T C 1: 173,481,231 T400A probably benign Het
Itga7 G A 10: 128,944,033 E480K probably null Het
Itpr1 T C 6: 108,493,794 Y2227H possibly damaging Het
Krt8 T C 15: 102,003,902 D113G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 A G 7: 66,708,095 probably benign Het
Lmf1 A T 17: 25,662,636 D553V possibly damaging Het
Lnpep A G 17: 17,566,730 S536P probably damaging Het
Lrp1b A T 2: 40,730,704 C3587* probably null Het
Macf1 A T 4: 123,397,124 D3435E possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Myg1 A T 15: 102,336,962 N206I probably damaging Het
Myl12a T G 17: 70,994,699 R144S probably benign Het
Myo5a T A 9: 75,147,897 I454K probably damaging Het
Nwd2 A G 5: 63,807,708 D1545G probably benign Het
Ogdhl T G 14: 32,339,224 D457E probably damaging Het
Olfr202 T A 16: 59,284,341 D52V probably damaging Het
Olfr466 A C 13: 65,152,774 L183F probably damaging Het
Paf1 A G 7: 28,395,670 I112V possibly damaging Het
Pcdhga4 C T 18: 37,686,745 P449L probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Ptgs1 A G 2: 36,237,222 Y40C probably damaging Het
Ptprn2 A T 12: 117,184,647 I676F probably damaging Het
Rev3l T C 10: 39,824,931 L1808P possibly damaging Het
Sall2 A G 14: 52,313,129 S868P probably damaging Het
Slc47a2 A G 11: 61,307,586 F428L probably benign Het
Slco3a1 A T 7: 74,284,615 F603Y possibly damaging Het
Smyd2 A T 1: 189,909,893 C65* probably null Het
Ssu72 T C 4: 155,715,550 F57L probably damaging Het
Tanc2 A G 11: 105,922,883 T1718A probably benign Het
Tnks G C 8: 34,965,566 P34A unknown Het
Top3a G A 11: 60,762,522 T42I probably damaging Het
Trank1 T C 9: 111,391,301 S2369P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqln1 T C 13: 58,183,183 Q410R probably damaging Het
Vmn2r11 A G 5: 109,059,358 I32T possibly damaging Het
Xcr1 A G 9: 123,856,310 F129S probably benign Het
Other mutations in Hey2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Hey2 APN 10 30834137 missense probably benign 0.25
IGL02525:Hey2 APN 10 30842647 start codon destroyed probably null 0.99
R0167:Hey2 UTSW 10 30840665 missense probably benign 0.04
R0279:Hey2 UTSW 10 30834010 missense probably damaging 0.97
R0553:Hey2 UTSW 10 30840489 splice site probably benign
R0592:Hey2 UTSW 10 30833957 missense probably benign 0.44
R0621:Hey2 UTSW 10 30834386 missense probably benign 0.36
R1437:Hey2 UTSW 10 30833849 missense probably benign 0.00
R1457:Hey2 UTSW 10 30834356 missense probably benign 0.45
R2449:Hey2 UTSW 10 30840446 missense possibly damaging 0.94
R4721:Hey2 UTSW 10 30834308 missense possibly damaging 0.65
R4755:Hey2 UTSW 10 30834304 missense probably benign 0.00
R4828:Hey2 UTSW 10 30834183 missense possibly damaging 0.95
R6927:Hey2 UTSW 10 30834417 missense probably benign 0.16
R7079:Hey2 UTSW 10 30834386 missense probably benign 0.36
R8196:Hey2 UTSW 10 30834277 missense probably benign
R8238:Hey2 UTSW 10 30840663 missense probably benign
R8381:Hey2 UTSW 10 30833990 missense probably damaging 1.00
R8383:Hey2 UTSW 10 30840669 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTGCTTGTCTGCTGAGGAC -3'
(R):5'- GCAGTGATGACATCCTCCATG -3'

Sequencing Primer
(F):5'- ACTGGAGGCTGCGGATAC -3'
(R):5'- ACTGGGCAGCTGCTTTC -3'
Posted On2016-09-01