Incidental Mutation 'R5419:Cyp2b23'
ID427920
Institutional Source Beutler Lab
Gene Symbol Cyp2b23
Ensembl Gene ENSMUSG00000040650
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 23
SynonymsEG243881
MMRRC Submission 042987-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5419 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location26665227-26686437 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 26681423 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 126 (R126*)
Ref Sequence ENSEMBL: ENSMUSP00000076578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077356]
Predicted Effect probably null
Transcript: ENSMUST00000077356
AA Change: R126*
SMART Domains Protein: ENSMUSP00000076578
Gene: ENSMUSG00000040650
AA Change: R126*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 488 2.9e-148 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,272,090 L926* probably null Het
4931429L15Rik C T 9: 46,309,326 probably null Het
Abca13 T A 11: 9,193,533 probably null Het
AI481877 A T 4: 59,049,017 M1116K probably benign Het
Akap13 A T 7: 75,610,243 T69S probably benign Het
Arl1 T A 10: 88,737,104 C80S probably damaging Het
Brsk1 A G 7: 4,709,004 T618A possibly damaging Het
Cep295 T C 9: 15,324,237 H1982R probably damaging Het
Ces5a A T 8: 93,499,431 S559T unknown Het
Clcf1 A G 19: 4,222,159 N90S possibly damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Cobll1 A T 2: 65,103,357 D430E possibly damaging Het
Cyp1a2 T A 9: 57,682,511 I7F probably benign Het
Daam2 A G 17: 49,480,754 W444R possibly damaging Het
Dcbld2 T A 16: 58,455,258 C446S probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Eif2d T C 1: 131,158,298 *177R probably null Het
Fkbp15 G A 4: 62,327,877 A438V probably damaging Het
Gjb5 G A 4: 127,355,859 A164V probably benign Het
Gm17727 T A 9: 35,778,111 probably null Het
Gm5724 C T 6: 141,736,100 probably null Het
Grin1 A T 2: 25,298,273 probably null Het
Grm3 A G 5: 9,570,233 F337S probably damaging Het
Hey2 T A 10: 30,834,023 T245S probably benign Het
Ifi206 T C 1: 173,481,231 T400A probably benign Het
Itga7 G A 10: 128,944,033 E480K probably null Het
Itpr1 T C 6: 108,493,794 Y2227H possibly damaging Het
Krt8 T C 15: 102,003,902 D113G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lins1 A G 7: 66,708,095 probably benign Het
Lmf1 A T 17: 25,662,636 D553V possibly damaging Het
Lnpep A G 17: 17,566,730 S536P probably damaging Het
Lrp1b A T 2: 40,730,704 C3587* probably null Het
Macf1 A T 4: 123,397,124 D3435E possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Myg1 A T 15: 102,336,962 N206I probably damaging Het
Myl12a T G 17: 70,994,699 R144S probably benign Het
Myo5a T A 9: 75,147,897 I454K probably damaging Het
Nwd2 A G 5: 63,807,708 D1545G probably benign Het
Ogdhl T G 14: 32,339,224 D457E probably damaging Het
Olfr202 T A 16: 59,284,341 D52V probably damaging Het
Olfr466 A C 13: 65,152,774 L183F probably damaging Het
Paf1 A G 7: 28,395,670 I112V possibly damaging Het
Pcdhga4 C T 18: 37,686,745 P449L probably damaging Het
Pla2g6 A T 15: 79,299,142 I495N possibly damaging Het
Ptgs1 A G 2: 36,237,222 Y40C probably damaging Het
Ptprn2 A T 12: 117,184,647 I676F probably damaging Het
Rev3l T C 10: 39,824,931 L1808P possibly damaging Het
Sall2 A G 14: 52,313,129 S868P probably damaging Het
Slc47a2 A G 11: 61,307,586 F428L probably benign Het
Slco3a1 A T 7: 74,284,615 F603Y possibly damaging Het
Smyd2 A T 1: 189,909,893 C65* probably null Het
Ssu72 T C 4: 155,715,550 F57L probably damaging Het
Tanc2 A G 11: 105,922,883 T1718A probably benign Het
Tnks G C 8: 34,965,566 P34A unknown Het
Top3a G A 11: 60,762,522 T42I probably damaging Het
Trank1 T C 9: 111,391,301 S2369P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqln1 T C 13: 58,183,183 Q410R probably damaging Het
Vmn2r11 A G 5: 109,059,358 I32T possibly damaging Het
Xcr1 A G 9: 123,856,310 F129S probably benign Het
Other mutations in Cyp2b23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Cyp2b23 APN 7 26679490 missense probably damaging 0.98
IGL01879:Cyp2b23 APN 7 26672854 missense probably benign 0.04
IGL02207:Cyp2b23 APN 7 26681755 missense probably damaging 1.00
IGL03047:Cyp2b23 APN 7 26681467 splice site probably benign
R0117:Cyp2b23 UTSW 7 26673114 missense probably benign 0.25
R0265:Cyp2b23 UTSW 7 26672879 splice site probably benign
R1457:Cyp2b23 UTSW 7 26673149 missense probably damaging 1.00
R1605:Cyp2b23 UTSW 7 26686418 missense probably benign 0.02
R1639:Cyp2b23 UTSW 7 26686417 missense possibly damaging 0.77
R1741:Cyp2b23 UTSW 7 26673077 missense possibly damaging 0.94
R2042:Cyp2b23 UTSW 7 26666108 missense probably damaging 1.00
R3911:Cyp2b23 UTSW 7 26681417 missense probably benign 0.02
R4078:Cyp2b23 UTSW 7 26673092 missense probably damaging 1.00
R4279:Cyp2b23 UTSW 7 26666027 missense possibly damaging 0.89
R4668:Cyp2b23 UTSW 7 26672734 missense probably damaging 1.00
R5516:Cyp2b23 UTSW 7 26673057 nonsense probably null
R5723:Cyp2b23 UTSW 7 26681396 missense probably benign 0.41
R5873:Cyp2b23 UTSW 7 26675006 missense probably benign 0.02
R6346:Cyp2b23 UTSW 7 26681725 missense probably damaging 0.98
R6977:Cyp2b23 UTSW 7 26681320 missense possibly damaging 0.87
R7131:Cyp2b23 UTSW 7 26681413 missense probably benign 0.25
R7181:Cyp2b23 UTSW 7 26674403 missense probably damaging 1.00
R7715:Cyp2b23 UTSW 7 26681695 missense probably benign
R7877:Cyp2b23 UTSW 7 26686426 missense probably damaging 0.97
R7880:Cyp2b23 UTSW 7 26673134 missense probably damaging 1.00
R8004:Cyp2b23 UTSW 7 26679466 missense probably benign
R8072:Cyp2b23 UTSW 7 26666006 missense probably damaging 1.00
R8083:Cyp2b23 UTSW 7 26686403 missense possibly damaging 0.62
Z1088:Cyp2b23 UTSW 7 26681411 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTCTGAAGAGAAGTGACCACC -3'
(R):5'- GCCAATTGTACAGGACTATGGTG -3'

Sequencing Primer
(F):5'- GAGAAGTGACCACCATTTTCAG -3'
(R):5'- ATTGTACAGGACTATGGTGAGATATG -3'
Posted On2016-09-01