Incidental Mutation 'R6212:Itgax'
ID 503507
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Name integrin alpha X
Synonyms CD11C (p150) alpha polypeptide, CR4, Cd11c
MMRRC Submission 044345-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R6212 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 127728719-127749829 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 127747025 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 942 (D942G)
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053]
AlphaFold Q9QXH4
Predicted Effect probably benign
Transcript: ENSMUST00000033053
AA Change: D942G

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: D942G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206396
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,172,505 (GRCm39) I116N probably damaging Het
Ap3b1 T C 13: 94,587,581 (GRCm39) S452P probably damaging Het
Ap3b1 C A 13: 94,630,207 (GRCm39) H821N unknown Het
Apex1 C T 14: 51,164,350 (GRCm39) P264S probably benign Het
Arhgap27 T C 11: 103,251,698 (GRCm39) Y10C probably damaging Het
Bag6 A G 17: 35,359,278 (GRCm39) T208A probably benign Het
Brd4 G T 17: 32,421,423 (GRCm39) P771Q probably damaging Het
Capn3 A G 2: 120,307,667 (GRCm39) S69G probably benign Het
Ccdc13 A G 9: 121,627,975 (GRCm39) probably benign Het
Celsr1 T C 15: 85,800,888 (GRCm39) H2519R probably benign Het
Chd8 T A 14: 52,439,155 (GRCm39) N48I probably damaging Het
Cmip T C 8: 118,103,895 (GRCm39) Y128H probably damaging Het
Dnhd1 C T 7: 105,353,255 (GRCm39) P2803S probably damaging Het
Dusp26 G A 8: 31,584,252 (GRCm39) D120N probably damaging Het
Epha6 T C 16: 60,245,719 (GRCm39) H160R possibly damaging Het
Erg C T 16: 95,180,022 (GRCm39) V215I probably damaging Het
Fbxo6 A T 4: 148,233,979 (GRCm39) I39N probably damaging Het
Gabbr2 T C 4: 46,681,189 (GRCm39) D124G probably damaging Het
Gapdh T C 6: 125,139,661 (GRCm39) H203R probably damaging Het
Garin1b T C 6: 29,319,373 (GRCm39) L59P probably damaging Het
Ggnbp2 T C 11: 84,727,503 (GRCm39) M42V possibly damaging Het
Hk2 C A 6: 82,705,823 (GRCm39) A827S probably benign Het
Hoxa5 T C 6: 52,179,694 (GRCm39) E227G probably damaging Het
Kars1 A T 8: 112,726,829 (GRCm39) probably null Het
Lama3 T C 18: 12,646,702 (GRCm39) F1739L probably damaging Het
Map2k1 A T 9: 64,112,445 (GRCm39) L155Q probably damaging Het
Mcf2l A T 8: 13,067,431 (GRCm39) D1013V probably damaging Het
Mocs1 G A 17: 49,742,224 (GRCm39) G118S probably damaging Het
Ncam2 T C 16: 81,229,650 (GRCm39) S37P probably damaging Het
Nfxl1 A G 5: 72,673,553 (GRCm39) probably null Het
Nodal C T 10: 61,259,300 (GRCm39) H246Y possibly damaging Het
Nwd1 G A 8: 73,421,950 (GRCm39) V999M possibly damaging Het
Oaz3 T A 3: 94,342,375 (GRCm39) T139S probably benign Het
Or6z6 T C 7: 6,491,367 (GRCm39) probably null Het
Or7e165 A G 9: 19,694,585 (GRCm39) D52G probably damaging Het
P3h3 T A 6: 124,822,606 (GRCm39) T522S probably benign Het
Pgap1 A G 1: 54,554,052 (GRCm39) F457S probably damaging Het
Prkce T C 17: 86,866,729 (GRCm39) Y530H probably damaging Het
Ptpn3 A T 4: 57,270,070 (GRCm39) C31S probably damaging Het
Rsf1 G GACGGCGGCA 7: 97,229,116 (GRCm39) probably benign Het
Serpinb6e T A 13: 34,025,220 (GRCm39) N24Y probably damaging Het
Slc4a8 T C 15: 100,709,452 (GRCm39) V937A possibly damaging Het
Smgc T A 15: 91,734,830 (GRCm39) probably benign Het
Srcap T A 7: 127,148,861 (GRCm39) N2027K probably damaging Het
Stra6l T C 4: 45,884,664 (GRCm39) Y565H probably benign Het
Tmem262 A G 19: 6,130,668 (GRCm39) E62G possibly damaging Het
Tnrc6a T A 7: 122,742,965 (GRCm39) probably null Het
Txlnb T C 10: 17,675,057 (GRCm39) I70T probably damaging Het
Whrn A T 4: 63,412,923 (GRCm39) L25* probably null Het
Zfp326 T A 5: 106,058,097 (GRCm39) V412E probably damaging Het
Zfp831 A G 2: 174,487,661 (GRCm39) R779G possibly damaging Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 127,734,498 (GRCm39) missense probably damaging 1.00
IGL00325:Itgax APN 7 127,747,481 (GRCm39) missense possibly damaging 0.69
IGL01155:Itgax APN 7 127,744,207 (GRCm39) missense probably benign 0.00
IGL01461:Itgax APN 7 127,734,190 (GRCm39) missense probably damaging 1.00
IGL01508:Itgax APN 7 127,743,990 (GRCm39) missense probably damaging 1.00
IGL01549:Itgax APN 7 127,730,378 (GRCm39) splice site probably null
IGL01864:Itgax APN 7 127,732,935 (GRCm39) missense probably benign 0.00
IGL02094:Itgax APN 7 127,730,645 (GRCm39) missense probably damaging 1.00
IGL02364:Itgax APN 7 127,739,154 (GRCm39) missense possibly damaging 0.89
IGL02969:Itgax APN 7 127,748,295 (GRCm39) missense probably benign
IGL03406:Itgax APN 7 127,748,370 (GRCm39) missense possibly damaging 0.93
Adendritic UTSW 7 127,747,744 (GRCm39) nonsense probably null
PIT4651001:Itgax UTSW 7 127,748,282 (GRCm39) missense probably benign 0.11
R0366:Itgax UTSW 7 127,748,261 (GRCm39) splice site probably benign
R0763:Itgax UTSW 7 127,747,112 (GRCm39) splice site probably benign
R1072:Itgax UTSW 7 127,749,316 (GRCm39) missense probably damaging 0.96
R1659:Itgax UTSW 7 127,730,063 (GRCm39) missense probably benign 0.15
R2019:Itgax UTSW 7 127,747,698 (GRCm39) missense probably benign
R2418:Itgax UTSW 7 127,741,505 (GRCm39) missense probably damaging 0.98
R3027:Itgax UTSW 7 127,747,744 (GRCm39) nonsense probably null
R3846:Itgax UTSW 7 127,732,939 (GRCm39) missense probably damaging 1.00
R3938:Itgax UTSW 7 127,735,445 (GRCm39) missense possibly damaging 0.73
R4021:Itgax UTSW 7 127,732,311 (GRCm39) critical splice donor site probably null
R4027:Itgax UTSW 7 127,740,438 (GRCm39) missense possibly damaging 0.75
R4163:Itgax UTSW 7 127,743,872 (GRCm39) missense probably benign 0.00
R4923:Itgax UTSW 7 127,747,700 (GRCm39) missense probably benign
R5259:Itgax UTSW 7 127,747,450 (GRCm39) missense probably damaging 0.99
R5333:Itgax UTSW 7 127,741,455 (GRCm39) missense probably damaging 1.00
R5347:Itgax UTSW 7 127,740,474 (GRCm39) missense probably benign 0.08
R5679:Itgax UTSW 7 127,734,162 (GRCm39) missense probably benign 0.00
R5725:Itgax UTSW 7 127,747,033 (GRCm39) missense possibly damaging 0.63
R5733:Itgax UTSW 7 127,739,647 (GRCm39) missense probably damaging 0.99
R5750:Itgax UTSW 7 127,743,878 (GRCm39) missense probably benign 0.32
R5964:Itgax UTSW 7 127,739,619 (GRCm39) missense probably damaging 1.00
R6004:Itgax UTSW 7 127,730,624 (GRCm39) missense probably damaging 0.96
R6168:Itgax UTSW 7 127,732,269 (GRCm39) missense probably damaging 0.99
R6212:Itgax UTSW 7 127,729,504 (GRCm39) missense possibly damaging 0.52
R6480:Itgax UTSW 7 127,747,771 (GRCm39) missense probably benign 0.12
R6484:Itgax UTSW 7 127,732,890 (GRCm39) missense probably benign 0.13
R6796:Itgax UTSW 7 127,734,236 (GRCm39) missense probably damaging 1.00
R6844:Itgax UTSW 7 127,747,106 (GRCm39) splice site probably null
R7287:Itgax UTSW 7 127,747,677 (GRCm39) missense probably damaging 1.00
R7365:Itgax UTSW 7 127,734,481 (GRCm39) missense probably damaging 1.00
R7421:Itgax UTSW 7 127,739,604 (GRCm39) missense probably damaging 1.00
R7599:Itgax UTSW 7 127,747,262 (GRCm39) missense probably damaging 0.99
R7710:Itgax UTSW 7 127,735,028 (GRCm39) missense probably benign 0.04
R7964:Itgax UTSW 7 127,739,590 (GRCm39) critical splice acceptor site probably null
R8220:Itgax UTSW 7 127,730,090 (GRCm39) missense probably benign 0.00
R8730:Itgax UTSW 7 127,739,066 (GRCm39) critical splice acceptor site probably null
R8742:Itgax UTSW 7 127,743,795 (GRCm39) missense probably benign 0.28
R8812:Itgax UTSW 7 127,732,979 (GRCm39) missense probably damaging 1.00
R8871:Itgax UTSW 7 127,735,223 (GRCm39) missense probably damaging 1.00
R9147:Itgax UTSW 7 127,747,913 (GRCm39) missense possibly damaging 0.74
R9149:Itgax UTSW 7 127,730,641 (GRCm39) missense probably benign 0.01
R9310:Itgax UTSW 7 127,741,432 (GRCm39) nonsense probably null
R9376:Itgax UTSW 7 127,747,935 (GRCm39) missense possibly damaging 0.94
R9377:Itgax UTSW 7 127,732,849 (GRCm39) missense probably benign 0.03
R9641:Itgax UTSW 7 127,741,152 (GRCm39) missense probably damaging 1.00
R9650:Itgax UTSW 7 127,734,935 (GRCm39) missense probably benign 0.24
R9709:Itgax UTSW 7 127,735,500 (GRCm39) missense probably damaging 1.00
X0061:Itgax UTSW 7 127,728,779 (GRCm39) start gained probably benign
Z1176:Itgax UTSW 7 127,744,044 (GRCm39) missense probably benign 0.24
Z1177:Itgax UTSW 7 127,747,234 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TAGCTGTTCCTGCATGGCTC -3'
(R):5'- CCCAAAAGTTGATGCTGACTG -3'

Sequencing Primer
(F):5'- CCTTTCGCCCACCCTGAAG -3'
(R):5'- AAGTTGATGCTGACTGGCACG -3'
Posted On 2018-02-27