Incidental Mutation 'R8742:Itgax'
ID 663287
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Name integrin alpha X
Synonyms CD11C (p150) alpha polypeptide, CR4, Cd11c
MMRRC Submission 068587-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R8742 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 127728719-127749829 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 127743795 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 852 (H852L)
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053]
AlphaFold Q9QXH4
Predicted Effect probably benign
Transcript: ENSMUST00000033053
AA Change: H852L

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: H852L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,265,835 (GRCm39) I893V probably benign Het
Adhfe1 A G 1: 9,630,401 (GRCm39) I317V probably benign Het
Adnp2 A G 18: 80,171,556 (GRCm39) V951A probably damaging Het
Ankrd35 T A 3: 96,586,502 (GRCm39) H59Q probably damaging Het
Atg16l1 C T 1: 87,694,620 (GRCm39) T161I probably damaging Het
Axl A G 7: 25,463,861 (GRCm39) V591A probably damaging Het
Cdc40 C T 10: 40,717,480 (GRCm39) D404N probably damaging Het
Cdcp3 A G 7: 130,783,741 (GRCm39) I45V unknown Het
Ceacam13 T A 7: 17,743,934 (GRCm39) S14T probably damaging Het
Cfh A T 1: 140,029,390 (GRCm39) F986L probably damaging Het
Cfh G T 1: 140,064,469 (GRCm39) T393K probably damaging Het
Clic1 A G 17: 35,274,356 (GRCm39) N179S probably benign Het
Col6a3 C G 1: 90,695,328 (GRCm39) probably benign Het
Dlat G T 9: 50,560,967 (GRCm39) A360E probably damaging Het
Dst T A 1: 34,251,425 (GRCm39) D2159E probably benign Het
Epn3 T G 11: 94,386,921 (GRCm39) T150P probably damaging Het
Fgr T C 4: 132,724,828 (GRCm39) Y310H probably damaging Het
Filip1l A G 16: 57,391,593 (GRCm39) Y727C probably damaging Het
Fis1 G T 5: 136,982,365 (GRCm39) probably benign Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gdf10 A T 14: 33,654,426 (GRCm39) H311L probably benign Het
Gphn C T 12: 78,659,766 (GRCm39) R423C probably damaging Het
Gpr132 T C 12: 112,819,517 (GRCm39) probably benign Het
Herc2 C A 7: 55,744,143 (GRCm39) T406K probably benign Het
Hpf1 T C 8: 61,346,748 (GRCm39) V21A probably benign Het
Ifitm6 A G 7: 140,596,008 (GRCm39) I75T probably benign Het
Klhl3 T C 13: 58,159,021 (GRCm39) Y546C probably damaging Het
Lbr A G 1: 181,644,571 (GRCm39) L578P possibly damaging Het
Ltbp1 A G 17: 75,617,217 (GRCm39) Y734C probably damaging Het
Mapre2 C A 18: 24,016,688 (GRCm39) H281N probably benign Het
Mcm4 T C 16: 15,443,430 (GRCm39) D831G possibly damaging Het
Mlf1 G A 3: 67,305,119 (GRCm39) A207T probably damaging Het
Mslnl A T 17: 25,964,047 (GRCm39) I459F probably damaging Het
Mtnr1a A G 8: 45,540,720 (GRCm39) D227G probably benign Het
Ncapg T A 5: 45,851,216 (GRCm39) L803Q probably damaging Het
Nr3c2 T G 8: 77,635,210 (GRCm39) S104A probably damaging Het
Or4k52 A G 2: 111,610,910 (GRCm39) I82V probably benign Het
Pard3 C T 8: 128,050,592 (GRCm39) A218V possibly damaging Het
Poteg A T 8: 27,984,957 (GRCm39) N439Y possibly damaging Het
Pramel34 T A 5: 93,785,935 (GRCm39) D115V probably damaging Het
Ret A T 6: 118,155,484 (GRCm39) L404Q probably damaging Het
Ripk4 A T 16: 97,556,272 (GRCm39) V157D probably damaging Het
Rsf1 CGGCGGCGGCGGCGGCGGCGGC CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,229,121 (GRCm39) probably benign Het
Serinc1 A T 10: 57,395,895 (GRCm39) N298K probably benign Het
Sh3pxd2a G A 19: 47,275,073 (GRCm39) S230L probably benign Het
Shb G C 4: 45,458,319 (GRCm39) R282G probably benign Het
Skint11 T C 4: 114,051,922 (GRCm39) I90T probably damaging Het
Slc36a4 A G 9: 15,632,039 (GRCm39) T72A probably damaging Het
Slc38a9 T A 13: 112,865,818 (GRCm39) I505K probably damaging Het
Sprr3 C T 3: 92,364,307 (GRCm39) R179H possibly damaging Het
Syne1 A T 10: 5,058,661 (GRCm39) I7284N probably benign Het
Timeless A T 10: 128,083,107 (GRCm39) T648S probably benign Het
Trim44 A G 2: 102,230,521 (GRCm39) M170T possibly damaging Het
Trpm7 A G 2: 126,667,469 (GRCm39) F815L probably damaging Het
Uimc1 A G 13: 55,240,971 (GRCm39) L39S possibly damaging Het
Vmn2r13 T C 5: 109,304,263 (GRCm39) T723A probably benign Het
Vps11 A G 9: 44,267,070 (GRCm39) probably benign Het
Zp3r A T 1: 130,511,230 (GRCm39) C383S probably damaging Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 127,734,498 (GRCm39) missense probably damaging 1.00
IGL00325:Itgax APN 7 127,747,481 (GRCm39) missense possibly damaging 0.69
IGL01155:Itgax APN 7 127,744,207 (GRCm39) missense probably benign 0.00
IGL01461:Itgax APN 7 127,734,190 (GRCm39) missense probably damaging 1.00
IGL01508:Itgax APN 7 127,743,990 (GRCm39) missense probably damaging 1.00
IGL01549:Itgax APN 7 127,730,378 (GRCm39) splice site probably null
IGL01864:Itgax APN 7 127,732,935 (GRCm39) missense probably benign 0.00
IGL02094:Itgax APN 7 127,730,645 (GRCm39) missense probably damaging 1.00
IGL02364:Itgax APN 7 127,739,154 (GRCm39) missense possibly damaging 0.89
IGL02969:Itgax APN 7 127,748,295 (GRCm39) missense probably benign
IGL03406:Itgax APN 7 127,748,370 (GRCm39) missense possibly damaging 0.93
Adendritic UTSW 7 127,747,744 (GRCm39) nonsense probably null
PIT4651001:Itgax UTSW 7 127,748,282 (GRCm39) missense probably benign 0.11
R0366:Itgax UTSW 7 127,748,261 (GRCm39) splice site probably benign
R0763:Itgax UTSW 7 127,747,112 (GRCm39) splice site probably benign
R1072:Itgax UTSW 7 127,749,316 (GRCm39) missense probably damaging 0.96
R1659:Itgax UTSW 7 127,730,063 (GRCm39) missense probably benign 0.15
R2019:Itgax UTSW 7 127,747,698 (GRCm39) missense probably benign
R2418:Itgax UTSW 7 127,741,505 (GRCm39) missense probably damaging 0.98
R3027:Itgax UTSW 7 127,747,744 (GRCm39) nonsense probably null
R3846:Itgax UTSW 7 127,732,939 (GRCm39) missense probably damaging 1.00
R3938:Itgax UTSW 7 127,735,445 (GRCm39) missense possibly damaging 0.73
R4021:Itgax UTSW 7 127,732,311 (GRCm39) critical splice donor site probably null
R4027:Itgax UTSW 7 127,740,438 (GRCm39) missense possibly damaging 0.75
R4163:Itgax UTSW 7 127,743,872 (GRCm39) missense probably benign 0.00
R4923:Itgax UTSW 7 127,747,700 (GRCm39) missense probably benign
R5259:Itgax UTSW 7 127,747,450 (GRCm39) missense probably damaging 0.99
R5333:Itgax UTSW 7 127,741,455 (GRCm39) missense probably damaging 1.00
R5347:Itgax UTSW 7 127,740,474 (GRCm39) missense probably benign 0.08
R5679:Itgax UTSW 7 127,734,162 (GRCm39) missense probably benign 0.00
R5725:Itgax UTSW 7 127,747,033 (GRCm39) missense possibly damaging 0.63
R5733:Itgax UTSW 7 127,739,647 (GRCm39) missense probably damaging 0.99
R5750:Itgax UTSW 7 127,743,878 (GRCm39) missense probably benign 0.32
R5964:Itgax UTSW 7 127,739,619 (GRCm39) missense probably damaging 1.00
R6004:Itgax UTSW 7 127,730,624 (GRCm39) missense probably damaging 0.96
R6168:Itgax UTSW 7 127,732,269 (GRCm39) missense probably damaging 0.99
R6212:Itgax UTSW 7 127,747,025 (GRCm39) missense probably benign 0.16
R6212:Itgax UTSW 7 127,729,504 (GRCm39) missense possibly damaging 0.52
R6480:Itgax UTSW 7 127,747,771 (GRCm39) missense probably benign 0.12
R6484:Itgax UTSW 7 127,732,890 (GRCm39) missense probably benign 0.13
R6796:Itgax UTSW 7 127,734,236 (GRCm39) missense probably damaging 1.00
R6844:Itgax UTSW 7 127,747,106 (GRCm39) splice site probably null
R7287:Itgax UTSW 7 127,747,677 (GRCm39) missense probably damaging 1.00
R7365:Itgax UTSW 7 127,734,481 (GRCm39) missense probably damaging 1.00
R7421:Itgax UTSW 7 127,739,604 (GRCm39) missense probably damaging 1.00
R7599:Itgax UTSW 7 127,747,262 (GRCm39) missense probably damaging 0.99
R7710:Itgax UTSW 7 127,735,028 (GRCm39) missense probably benign 0.04
R7964:Itgax UTSW 7 127,739,590 (GRCm39) critical splice acceptor site probably null
R8220:Itgax UTSW 7 127,730,090 (GRCm39) missense probably benign 0.00
R8730:Itgax UTSW 7 127,739,066 (GRCm39) critical splice acceptor site probably null
R8812:Itgax UTSW 7 127,732,979 (GRCm39) missense probably damaging 1.00
R8871:Itgax UTSW 7 127,735,223 (GRCm39) missense probably damaging 1.00
R9147:Itgax UTSW 7 127,747,913 (GRCm39) missense possibly damaging 0.74
R9149:Itgax UTSW 7 127,730,641 (GRCm39) missense probably benign 0.01
R9310:Itgax UTSW 7 127,741,432 (GRCm39) nonsense probably null
R9376:Itgax UTSW 7 127,747,935 (GRCm39) missense possibly damaging 0.94
R9377:Itgax UTSW 7 127,732,849 (GRCm39) missense probably benign 0.03
R9641:Itgax UTSW 7 127,741,152 (GRCm39) missense probably damaging 1.00
R9650:Itgax UTSW 7 127,734,935 (GRCm39) missense probably benign 0.24
R9709:Itgax UTSW 7 127,735,500 (GRCm39) missense probably damaging 1.00
X0061:Itgax UTSW 7 127,728,779 (GRCm39) start gained probably benign
Z1176:Itgax UTSW 7 127,744,044 (GRCm39) missense probably benign 0.24
Z1177:Itgax UTSW 7 127,747,234 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGGTGAGGGTTTCTATGACTAGAC -3'
(R):5'- CTCTGGCTCTTAGAAGCAGC -3'

Sequencing Primer
(F):5'- CCTTCTACACAACAGGAGGTTTG -3'
(R):5'- TCTTAGAAGCAGCCGGTCC -3'
Posted On 2021-03-08