Incidental Mutation 'R8742:Itgax'
ID663287
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Nameintegrin alpha X
SynonymsCd11c, CD11C (p150) alpha polypeptide
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R8742 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location128129547-128150657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128144623 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 852 (H852L)
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053]
Predicted Effect probably benign
Transcript: ENSMUST00000033053
AA Change: H852L

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: H852L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,182,012 I45V unknown Het
Adgrb3 T C 1: 25,226,754 I893V probably benign Het
Adhfe1 A G 1: 9,560,176 I317V probably benign Het
Adnp2 A G 18: 80,128,341 V951A probably damaging Het
Ankrd35 T A 3: 96,679,186 H59Q probably damaging Het
Atg16l1 C T 1: 87,766,898 T161I probably damaging Het
Axl A G 7: 25,764,436 V591A probably damaging Het
C87414 T A 5: 93,638,076 D115V probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Ceacam13 T A 7: 18,010,009 S14T probably damaging Het
Cfh A T 1: 140,101,652 F986L probably damaging Het
Cfh G T 1: 140,136,731 T393K probably damaging Het
Clic1 A G 17: 35,055,380 N179S probably benign Het
Col6a3 C G 1: 90,767,606 probably benign Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dst T A 1: 34,212,344 D2159E probably benign Het
Epn3 T G 11: 94,496,095 T150P probably damaging Het
Fgr T C 4: 132,997,517 Y310H probably damaging Het
Filip1l A G 16: 57,571,230 Y727C probably damaging Het
Fis1 G T 5: 136,953,511 probably benign Het
Gdf10 A T 14: 33,932,469 H311L probably benign Het
Gphn C T 12: 78,612,992 R423C probably damaging Het
Gpr132 T C 12: 112,855,897 probably benign Het
Herc2 C A 7: 56,094,395 T406K probably benign Het
Hpf1 T C 8: 60,893,714 V21A probably benign Het
Ifitm6 A G 7: 141,016,095 I75T probably benign Het
Klhl3 T C 13: 58,011,207 Y546C probably damaging Het
Lbr A G 1: 181,817,006 L578P possibly damaging Het
Ltbp1 A G 17: 75,310,222 Y734C probably damaging Het
Mapre2 C A 18: 23,883,631 H281N probably benign Het
Mcm4 T C 16: 15,625,566 D831G possibly damaging Het
Mlf1 G A 3: 67,397,786 A207T probably damaging Het
Mslnl A T 17: 25,745,073 I459F probably damaging Het
Mtnr1a A G 8: 45,087,683 D227G probably benign Het
Ncapg T A 5: 45,693,874 L803Q probably damaging Het
Nr3c2 T G 8: 76,908,581 S104A probably damaging Het
Olfr1302 A G 2: 111,780,565 I82V probably benign Het
Pard3 C T 8: 127,324,111 A218V possibly damaging Het
Poteg A T 8: 27,494,929 N439Y possibly damaging Het
Ret A T 6: 118,178,523 L404Q probably damaging Het
Ripk4 A T 16: 97,755,072 V157D probably damaging Het
Rsf1 CGGCGGCGGCGGCGGCGGCGGC CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,914 probably benign Het
Serinc1 A T 10: 57,519,799 N298K probably benign Het
Shb G C 4: 45,458,319 R282G probably benign Het
Skint11 T C 4: 114,194,725 I90T probably damaging Het
Slc36a4 A G 9: 15,720,743 T72A probably damaging Het
Slc38a9 T A 13: 112,729,284 I505K probably damaging Het
Sprr3 C T 3: 92,457,000 R179H possibly damaging Het
Syne1 A T 10: 5,108,661 I7284N probably benign Het
Timeless A T 10: 128,247,238 T648S probably benign Het
Trim44 A G 2: 102,400,176 M170T possibly damaging Het
Trpm7 A G 2: 126,825,549 F815L probably damaging Het
Uimc1 A G 13: 55,093,158 L39S possibly damaging Het
Vmn2r13 T C 5: 109,156,397 T723A probably benign Het
Zp3r A T 1: 130,583,493 C383S probably damaging Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 128135326 missense probably damaging 1.00
IGL00325:Itgax APN 7 128148309 missense possibly damaging 0.69
IGL01155:Itgax APN 7 128145035 missense probably benign 0.00
IGL01461:Itgax APN 7 128135018 missense probably damaging 1.00
IGL01508:Itgax APN 7 128144818 missense probably damaging 1.00
IGL01549:Itgax APN 7 128131206 splice site probably null
IGL01864:Itgax APN 7 128133763 missense probably benign 0.00
IGL02094:Itgax APN 7 128131473 missense probably damaging 1.00
IGL02364:Itgax APN 7 128139982 missense possibly damaging 0.89
IGL02969:Itgax APN 7 128149123 missense probably benign
IGL03406:Itgax APN 7 128149198 missense possibly damaging 0.93
Adendritic UTSW 7 128148572 nonsense probably null
PIT4651001:Itgax UTSW 7 128149110 missense probably benign 0.11
R0366:Itgax UTSW 7 128149089 splice site probably benign
R0763:Itgax UTSW 7 128147940 splice site probably benign
R1072:Itgax UTSW 7 128150144 missense probably damaging 0.96
R1659:Itgax UTSW 7 128130891 missense probably benign 0.15
R2019:Itgax UTSW 7 128148526 missense probably benign
R2418:Itgax UTSW 7 128142333 missense probably damaging 0.98
R3027:Itgax UTSW 7 128148572 nonsense probably null
R3846:Itgax UTSW 7 128133767 missense probably damaging 1.00
R3938:Itgax UTSW 7 128136273 missense possibly damaging 0.73
R4021:Itgax UTSW 7 128133139 critical splice donor site probably null
R4027:Itgax UTSW 7 128141266 missense possibly damaging 0.75
R4163:Itgax UTSW 7 128144700 missense probably benign 0.00
R4923:Itgax UTSW 7 128148528 missense probably benign
R5259:Itgax UTSW 7 128148278 missense probably damaging 0.99
R5333:Itgax UTSW 7 128142283 missense probably damaging 1.00
R5347:Itgax UTSW 7 128141302 missense probably benign 0.08
R5679:Itgax UTSW 7 128134990 missense probably benign 0.00
R5725:Itgax UTSW 7 128147861 missense possibly damaging 0.63
R5733:Itgax UTSW 7 128140475 missense probably damaging 0.99
R5750:Itgax UTSW 7 128144706 missense probably benign 0.32
R5964:Itgax UTSW 7 128140447 missense probably damaging 1.00
R6004:Itgax UTSW 7 128131452 missense probably damaging 0.96
R6168:Itgax UTSW 7 128133097 missense probably damaging 0.99
R6212:Itgax UTSW 7 128130332 missense possibly damaging 0.52
R6212:Itgax UTSW 7 128147853 missense probably benign 0.16
R6480:Itgax UTSW 7 128148599 missense probably benign 0.12
R6484:Itgax UTSW 7 128133718 missense probably benign 0.13
R6796:Itgax UTSW 7 128135064 missense probably damaging 1.00
R6844:Itgax UTSW 7 128147934 splice site probably null
R7287:Itgax UTSW 7 128148505 missense probably damaging 1.00
R7365:Itgax UTSW 7 128135309 missense probably damaging 1.00
R7421:Itgax UTSW 7 128140432 missense probably damaging 1.00
R7599:Itgax UTSW 7 128148090 missense probably damaging 0.99
R7710:Itgax UTSW 7 128135856 missense probably benign 0.04
R7964:Itgax UTSW 7 128140418 critical splice acceptor site probably null
R8220:Itgax UTSW 7 128130918 missense probably benign 0.00
R8730:Itgax UTSW 7 128139894 critical splice acceptor site probably null
R8812:Itgax UTSW 7 128133807 missense probably damaging 1.00
R8871:Itgax UTSW 7 128136051 missense probably damaging 1.00
X0061:Itgax UTSW 7 128129607 start gained probably benign
Z1176:Itgax UTSW 7 128144872 missense probably benign 0.24
Z1177:Itgax UTSW 7 128148062 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGGTGAGGGTTTCTATGACTAGAC -3'
(R):5'- CTCTGGCTCTTAGAAGCAGC -3'

Sequencing Primer
(F):5'- CCTTCTACACAACAGGAGGTTTG -3'
(R):5'- TCTTAGAAGCAGCCGGTCC -3'
Posted On2021-03-08