Incidental Mutation 'R6259:Rag1'
ID506526
Institutional Source Beutler Lab
Gene Symbol Rag1
Ensembl Gene ENSMUSG00000061311
Gene Namerecombination activating gene 1
SynonymsRag-1
MMRRC Submission 044376-MU
Accession Numbers

MGI:97848

Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock #R6259 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location101638282-101649501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101644452 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 115 (N115I)
Ref Sequence ENSEMBL: ENSMUSP00000077584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078494] [ENSMUST00000160037] [ENSMUST00000160722]
PDB Structure
RAG1 DIMERIZATION DOMAIN [X-RAY DIFFRACTION]
Crystal structure of the RAG1 nonamer-binding domain with DNA [X-RAY DIFFRACTION]
Crystal structure of the RAG1 nonamer-binding domain with DNA [X-RAY DIFFRACTION]
Crystal structure of the core RAG1/2 recombinase [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078494
AA Change: N115I

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077584
Gene: ENSMUSG00000061311
AA Change: N115I

DomainStartEndE-ValueType
Pfam:RAG1_imp_bd 11 288 5.7e-120 PFAM
RING 290 328 1.39e-3 SMART
ZnF_C2H2 353 376 2.61e1 SMART
PDB:3GNB|A 389 464 3e-44 PDB
ZnF_C2H2 725 750 7e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160037
Predicted Effect probably benign
Transcript: ENSMUST00000160722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177171
Meta Mutation Damage Score 0.1080 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in activation of immunoglobulin V-D-J recombination. The encoded protein is involved in recognition of the DNA substrate, but stable binding and cleavage activity also requires RAG2. Defects in this gene can be the cause of several diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of T and B cell maturation at the CD4-8- thymocyte or B220+/CD43+pro-B cell stage due to inability to undergo V(D)J recombination. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(10) Chemically induced(3)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,513 Y96C probably benign Het
5730507C01Rik C A 12: 18,534,119 N393K probably benign Het
Acap3 A T 4: 155,896,118 I19F possibly damaging Het
Adamts5 C T 16: 85,899,753 R172H probably benign Het
Adgra3 A G 5: 49,999,141 F416L possibly damaging Het
Amy1 T C 3: 113,569,410 D96G possibly damaging Het
Ank2 A G 3: 127,016,986 S484P probably benign Het
Arsa A G 15: 89,475,521 C68R probably damaging Het
Asprv1 A G 6: 86,628,379 Y69C probably benign Het
Ass1 A G 2: 31,488,642 E162G possibly damaging Het
Atf7 G T 15: 102,547,238 N230K probably damaging Het
Atp10b A G 11: 43,201,238 M367V probably benign Het
Atp11b A G 3: 35,806,901 Y179C probably damaging Het
BC004004 A T 17: 29,298,712 Q300L possibly damaging Het
Bglap3 A T 3: 88,368,760 I95N probably damaging Het
Cacna1h T C 17: 25,397,656 probably null Het
Caskin2 C T 11: 115,800,453 G1141D probably damaging Het
Clcn4 G A 7: 7,291,530 R351W possibly damaging Het
Col11a1 T C 3: 114,138,447 C89R probably benign Het
Csrp1 T G 1: 135,739,514 probably null Het
Cwf19l2 T C 9: 3,458,879 I776T probably damaging Het
Cyp2b19 A T 7: 26,771,392 Q486L possibly damaging Het
Cyp2j9 T A 4: 96,584,006 Y165F probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dennd1c G A 17: 57,067,104 R522C probably damaging Het
Dmgdh T C 13: 93,752,308 V818A probably benign Het
Dst T A 1: 34,182,396 V2427E probably benign Het
Duox1 C T 2: 122,344,783 T1354M probably benign Het
Ehbp1 A G 11: 22,285,684 probably benign Het
Epc2 T A 2: 49,488,854 probably null Het
Eya2 T C 2: 165,716,099 V205A probably benign Het
Fam84a T A 12: 14,150,645 D27V probably damaging Het
Fat4 A G 3: 39,007,246 H4326R probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Gm10100 G T 10: 77,726,664 C60F possibly damaging Het
Hhip T A 8: 79,972,404 R678W probably damaging Het
Il21r T A 7: 125,630,719 I266K possibly damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kif26b T C 1: 178,917,405 S1689P probably damaging Het
L3mbtl2 A G 15: 81,681,927 E317G probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrr1 A G 12: 69,174,815 N244D probably damaging Het
Lrrk2 A T 15: 91,702,247 H422L probably benign Het
Map4k5 A G 12: 69,852,740 S46P probably damaging Het
Ngf A G 3: 102,509,797 probably benign Het
Nploc4 T C 11: 120,385,865 I452V probably benign Het
Oas1d T A 5: 120,919,181 Y283* probably null Het
Olfr1156 T C 2: 87,949,435 N266S probably benign Het
Olfr1463 A G 19: 13,234,421 H57R probably damaging Het
Olfr648 A T 7: 104,180,054 M118K possibly damaging Het
Olfr689 A T 7: 105,314,057 I18F probably benign Het
Pdzrn4 A T 15: 92,757,681 E485V probably damaging Het
Peg3 A G 7: 6,709,811 V804A probably damaging Het
Piezo2 T A 18: 63,117,678 Y450F possibly damaging Het
Pprc1 T A 19: 46,064,410 V789E probably damaging Het
Prcc A G 3: 87,862,147 M436T possibly damaging Het
Prepl A T 17: 85,070,431 V507D probably damaging Het
Rap1gap T C 4: 137,681,757 probably null Het
Reln A C 5: 22,060,333 F454V probably damaging Het
Slc39a11 A T 11: 113,463,954 S150T probably benign Het
Slc45a1 T A 4: 150,638,360 I356F possibly damaging Het
Snrnp200 G A 2: 127,218,423 G529D possibly damaging Het
Stkld1 A T 2: 26,949,381 D353V possibly damaging Het
Susd2 T C 10: 75,638,046 S572G probably damaging Het
Synrg T A 11: 84,008,658 D563E probably damaging Het
Tmem131 C T 1: 36,819,128 V713I probably benign Het
Tnfrsf8 A G 4: 145,277,524 probably null Het
Trim26 C T 17: 36,856,218 A267V probably benign Het
Trpm1 T G 7: 64,268,478 F522C possibly damaging Het
Uggt1 T C 1: 36,234,916 I29V probably benign Het
Unc5d C T 8: 28,666,792 M808I probably benign Het
Vmn2r108 T A 17: 20,463,109 D611V possibly damaging Het
Vps13a A C 19: 16,687,170 Y1436* probably null Het
Wdfy3 C T 5: 101,872,965 R2491Q possibly damaging Het
Zfp518a G T 19: 40,912,781 V385F probably benign Het
Zfp541 C T 7: 16,095,526 A1222V probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Rag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Rag1 APN 2 101642388 missense probably damaging 1.00
IGL01125:Rag1 APN 2 101642001 missense probably damaging 0.99
IGL01836:Rag1 APN 2 101641894 missense probably damaging 1.00
IGL02216:Rag1 APN 2 101643381 missense possibly damaging 0.91
IGL02271:Rag1 APN 2 101643388 missense probably damaging 0.99
IGL02293:Rag1 APN 2 101643046 missense probably benign 0.39
IGL02601:Rag1 APN 2 101642673 missense probably damaging 1.00
anne UTSW 2 101643516 missense probably damaging 0.99
busted UTSW 2 101641947 missense probably damaging 1.00
defective UTSW 2 101642710 missense probably damaging 1.00
doll UTSW 2 101642070 missense probably damaging 1.00
dysfunctional UTSW 2 101644284 missense probably damaging 1.00
huckle UTSW 2 101641223 intron probably benign
maladaptive UTSW 2 101645647 intron probably benign
scarecrow UTSW 2 101642507 missense probably damaging 1.00
R0658:Rag1 UTSW 2 101642683 missense probably damaging 0.99
R1126:Rag1 UTSW 2 101642689 missense probably damaging 1.00
R1177:Rag1 UTSW 2 101642278 missense probably benign 0.10
R1319:Rag1 UTSW 2 101643192 missense probably damaging 1.00
R1513:Rag1 UTSW 2 101642991 missense possibly damaging 0.95
R1859:Rag1 UTSW 2 101644062 missense probably benign 0.03
R2218:Rag1 UTSW 2 101644146 missense probably benign
R3932:Rag1 UTSW 2 101643039 missense probably damaging 1.00
R4127:Rag1 UTSW 2 101642071 missense probably damaging 1.00
R4365:Rag1 UTSW 2 101642943 missense probably damaging 1.00
R4620:Rag1 UTSW 2 101643680 missense probably damaging 1.00
R4815:Rag1 UTSW 2 101643516 missense probably damaging 0.99
R5070:Rag1 UTSW 2 101642311 missense probably damaging 1.00
R5209:Rag1 UTSW 2 101644215 missense probably benign 0.01
R5239:Rag1 UTSW 2 101642955 missense possibly damaging 0.91
R5390:Rag1 UTSW 2 101642734 missense probably benign
R5607:Rag1 UTSW 2 101643792 missense probably damaging 1.00
R6412:Rag1 UTSW 2 101642520 missense probably damaging 0.99
R6633:Rag1 UTSW 2 101642710 missense probably damaging 1.00
R6679:Rag1 UTSW 2 101644284 missense probably damaging 1.00
R6723:Rag1 UTSW 2 101643645 missense probably damaging 0.99
R6853:Rag1 UTSW 2 101642221 missense probably damaging 0.99
R6867:Rag1 UTSW 2 101641947 missense probably damaging 1.00
R6974:Rag1 UTSW 2 101641792 missense probably damaging 0.99
R7071:Rag1 UTSW 2 101643462 missense probably damaging 0.99
R7124:Rag1 UTSW 2 101643783 missense probably damaging 0.99
R7248:Rag1 UTSW 2 101641778 missense probably damaging 0.99
R7256:Rag1 UTSW 2 101642070 missense probably damaging 1.00
R7567:Rag1 UTSW 2 101643661 missense probably damaging 0.98
R7581:Rag1 UTSW 2 101643304 missense possibly damaging 0.95
R7830:Rag1 UTSW 2 101642059 missense probably damaging 1.00
R7941:Rag1 UTSW 2 101642346 missense probably benign 0.24
R8024:Rag1 UTSW 2 101642507 missense probably damaging 1.00
R8434:Rag1 UTSW 2 101642664 missense probably damaging 1.00
X0018:Rag1 UTSW 2 101643597 missense probably damaging 1.00
X0018:Rag1 UTSW 2 101644547 missense probably damaging 0.99
Z1176:Rag1 UTSW 2 101643259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGATGCTCCAACAGTCATGG -3'
(R):5'- GGATTCCTCAGAGGGGAAAC -3'

Sequencing Primer
(F):5'- AGTCATGGCAGAATTCCGTC -3'
(R):5'- CCTTACCTAGAACAGTCTCCAGTAG -3'
Posted On2018-03-15