Mutagenetix > Incidental Mutation

Incidental Mutation 'R6259:Trpm1'

506552

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

044376-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6259 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 64268478 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Cysteine at position 522 (F522C)

Ref Sequence

ENSEMBL: ENSMUSP00000145593 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]

AlphaFold

Q2TV84

Predicted Effect

probably benign
Transcript: ENSMUST00000085222
AA Change: F1406C

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: F1406C

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205466

Predicted Effect

probably benign
Transcript: ENSMUST00000206263
AA Change: F1290C

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

probably benign
Transcript: ENSMUST00000206277
AA Change: F1412C

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206314
AA Change: F522C

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000206848

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.0%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	G	17: 56,877,513	Y96C	probably benign	Het
5730507C01Rik	C	A	12: 18,534,119	N393K	probably benign	Het
Acap3	A	T	4: 155,896,118	I19F	possibly damaging	Het
Adamts5	C	T	16: 85,899,753	R172H	probably benign	Het
Adgra3	A	G	5: 49,999,141	F416L	possibly damaging	Het
Amy1	T	C	3: 113,569,410	D96G	possibly damaging	Het
Ank2	A	G	3: 127,016,986	S484P	probably benign	Het
Arsa	A	G	15: 89,475,521	C68R	probably damaging	Het
Asprv1	A	G	6: 86,628,379	Y69C	probably benign	Het
Ass1	A	G	2: 31,488,642	E162G	possibly damaging	Het
Atf7	G	T	15: 102,547,238	N230K	probably damaging	Het
Atp10b	A	G	11: 43,201,238	M367V	probably benign	Het
Atp11b	A	G	3: 35,806,901	Y179C	probably damaging	Het
BC004004	A	T	17: 29,298,712	Q300L	possibly damaging	Het
Bglap3	A	T	3: 88,368,760	I95N	probably damaging	Het
Cacna1h	T	C	17: 25,397,656		probably null	Het
Caskin2	C	T	11: 115,800,453	G1141D	probably damaging	Het
Clcn4	G	A	7: 7,291,530	R351W	possibly damaging	Het
Col11a1	T	C	3: 114,138,447	C89R	probably benign	Het
Csrp1	T	G	1: 135,739,514		probably null	Het
Cwf19l2	T	C	9: 3,458,879	I776T	probably damaging	Het
Cyp2b19	A	T	7: 26,771,392	Q486L	possibly damaging	Het
Cyp2j9	T	A	4: 96,584,006	Y165F	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dennd1c	G	A	17: 57,067,104	R522C	probably damaging	Het
Dmgdh	T	C	13: 93,752,308	V818A	probably benign	Het
Dst	T	A	1: 34,182,396	V2427E	probably benign	Het
Duox1	C	T	2: 122,344,783	T1354M	probably benign	Het
Ehbp1	A	G	11: 22,285,684		probably benign	Het
Epc2	T	A	2: 49,488,854		probably null	Het
Eya2	T	C	2: 165,716,099	V205A	probably benign	Het
Fam84a	T	A	12: 14,150,645	D27V	probably damaging	Het
Fat4	A	G	3: 39,007,246	H4326R	probably benign	Het
Gaa	C	A	11: 119,281,171	A700D	probably benign	Het
Gm10100	G	T	10: 77,726,664	C60F	possibly damaging	Het
Hhip	T	A	8: 79,972,404	R678W	probably damaging	Het
Il21r	T	A	7: 125,630,719	I266K	possibly damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Kif26b	T	C	1: 178,917,405	S1689P	probably damaging	Het
L3mbtl2	A	G	15: 81,681,927	E317G	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrr1	A	G	12: 69,174,815	N244D	probably damaging	Het
Lrrk2	A	T	15: 91,702,247	H422L	probably benign	Het
Map4k5	A	G	12: 69,852,740	S46P	probably damaging	Het
Ngf	A	G	3: 102,509,797		probably benign	Het
Nploc4	T	C	11: 120,385,865	I452V	probably benign	Het
Oas1d	T	A	5: 120,919,181	Y283*	probably null	Het
Olfr1156	T	C	2: 87,949,435	N266S	probably benign	Het
Olfr1463	A	G	19: 13,234,421	H57R	probably damaging	Het
Olfr648	A	T	7: 104,180,054	M118K	possibly damaging	Het
Olfr689	A	T	7: 105,314,057	I18F	probably benign	Het
Pdzrn4	A	T	15: 92,757,681	E485V	probably damaging	Het
Peg3	A	G	7: 6,709,811	V804A	probably damaging	Het
Piezo2	T	A	18: 63,117,678	Y450F	possibly damaging	Het
Pprc1	T	A	19: 46,064,410	V789E	probably damaging	Het
Prcc	A	G	3: 87,862,147	M436T	possibly damaging	Het
Prepl	A	T	17: 85,070,431	V507D	probably damaging	Het
Rag1	T	A	2: 101,644,452	N115I	possibly damaging	Het
Rap1gap	T	C	4: 137,681,757		probably null	Het
Reln	A	C	5: 22,060,333	F454V	probably damaging	Het
Slc39a11	A	T	11: 113,463,954	S150T	probably benign	Het
Slc45a1	T	A	4: 150,638,360	I356F	possibly damaging	Het
Snrnp200	G	A	2: 127,218,423	G529D	possibly damaging	Het
Stkld1	A	T	2: 26,949,381	D353V	possibly damaging	Het
Susd2	T	C	10: 75,638,046	S572G	probably damaging	Het
Synrg	T	A	11: 84,008,658	D563E	probably damaging	Het
Tmem131	C	T	1: 36,819,128	V713I	probably benign	Het
Tnfrsf8	A	G	4: 145,277,524		probably null	Het
Trim26	C	T	17: 36,856,218	A267V	probably benign	Het
Uggt1	T	C	1: 36,234,916	I29V	probably benign	Het
Unc5d	C	T	8: 28,666,792	M808I	probably benign	Het
Vmn2r108	T	A	17: 20,463,109	D611V	possibly damaging	Het
Vps13a	A	C	19: 16,687,170	Y1436*	probably null	Het
Wdfy3	C	T	5: 101,872,965	R2491Q	possibly damaging	Het
Zfp518a	G	T	19: 40,912,781	V385F	probably benign	Het
Zfp541	C	T	7: 16,095,526	A1222V	probably benign	Het
Zfp709	TCGACG	TCG	8: 71,890,708		probably benign	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AACCTACTCCTTTCGTGTGAAGG -3'
(R):5'- TTGCTAAGACCTCGGACTAGC -3'

Sequencing Primer
(F):5'- CCTACTCCTTTCGTGTGAAGGATGAG -3'
(R):5'- AGACGAAGCTTCTGGACTTC -3'

Posted On

2018-03-15