Incidental Mutation 'R6282:Ktn1'
ID508016
Institutional Source Beutler Lab
Gene Symbol Ktn1
Ensembl Gene ENSMUSG00000021843
Gene Namekinectin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6282 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location47648448-47739894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47663971 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 62 (N62I)
Ref Sequence ENSEMBL: ENSMUSP00000140301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022391] [ENSMUST00000185343] [ENSMUST00000185940] [ENSMUST00000186466] [ENSMUST00000186627] [ENSMUST00000186761] [ENSMUST00000187039] [ENSMUST00000187262] [ENSMUST00000187839] [ENSMUST00000188330] [ENSMUST00000188553] [ENSMUST00000189101] [ENSMUST00000189533] [ENSMUST00000189986] [ENSMUST00000190182] [ENSMUST00000190252] [ENSMUST00000190535] [ENSMUST00000190999] [ENSMUST00000191018] [ENSMUST00000191446] [ENSMUST00000191511]
Predicted Effect probably damaging
Transcript: ENSMUST00000022391
AA Change: N62I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022391
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1267 N/A INTRINSIC
coiled coil region 1302 1326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185343
AA Change: N62I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140186
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1192 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185940
AA Change: N62I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139625
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1163 N/A INTRINSIC
coiled coil region 1198 1222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186466
AA Change: N62I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140523
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
Pfam:Rib_recp_KP_reg 29 173 9.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186627
AA Change: N62I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140873
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186761
AA Change: N62I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139521
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1016 N/A INTRINSIC
coiled coil region 1060 1210 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187039
AA Change: N62I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140202
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1163 N/A INTRINSIC
coiled coil region 1198 1222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187262
AA Change: N62I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140206
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1215 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187839
AA Change: N62I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140324
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1267 N/A INTRINSIC
coiled coil region 1302 1326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188330
AA Change: N62I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140845
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1187 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188553
AA Change: N62I

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140865
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1216 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189101
AA Change: N62I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140178
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1163 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189533
AA Change: N62I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140142
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1187 N/A INTRINSIC
coiled coil region 1222 1246 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189986
AA Change: N62I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139970
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
Pfam:Rib_recp_KP_reg 29 172 2.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190182
AA Change: N62I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140301
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1016 N/A INTRINSIC
coiled coil region 1060 1238 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190252
AA Change: N62I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140011
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1016 N/A INTRINSIC
coiled coil region 1060 1210 N/A INTRINSIC
coiled coil region 1245 1269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190535
AA Change: N62I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139952
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1244 N/A INTRINSIC
coiled coil region 1279 1303 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190999
AA Change: N62I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139673
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 993 N/A INTRINSIC
coiled coil region 1037 1215 N/A INTRINSIC
coiled coil region 1250 1274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191018
AA Change: N62I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139585
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1220 N/A INTRINSIC
coiled coil region 1255 1279 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191446
AA Change: N62I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140748
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 1028 N/A INTRINSIC
coiled coil region 1089 1215 N/A INTRINSIC
coiled coil region 1250 1274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191511
AA Change: N62I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139946
Gene: ENSMUSG00000021843
AA Change: N62I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
coiled coil region 40 66 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 203 221 N/A INTRINSIC
coiled coil region 329 372 N/A INTRINSIC
coiled coil region 402 727 N/A INTRINSIC
coiled coil region 764 792 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
coiled coil region 836 1005 N/A INTRINSIC
coiled coil region 1066 1192 N/A INTRINSIC
coiled coil region 1227 1251 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation or a floxed allele exhibit no discernable phenotype; mice are viable and fertile up to one year of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,800,769 L185Q possibly damaging Het
Abca6 A T 11: 110,208,824 C966S probably damaging Het
Atp13a4 A T 16: 29,434,004 I708N probably benign Het
Axin1 C G 17: 26,143,037 D118E probably damaging Het
Bace2 A T 16: 97,415,097 I297F probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Ccdc30 T A 4: 119,324,017 D649V probably damaging Het
Cd180 G A 13: 102,693,757 A20T possibly damaging Het
Cdk18 T C 1: 132,120,020 D112G probably damaging Het
Cuedc1 A G 11: 88,183,402 N254S probably damaging Het
Dnah7a T C 1: 53,503,601 H2470R probably damaging Het
Drap1 G A 19: 5,424,436 probably null Het
Fam196b A G 11: 34,402,819 D287G possibly damaging Het
Fbxo5 T A 10: 5,801,216 K257M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12790 A G 4: 101,967,516 V185A possibly damaging Het
Gm7361 A G 5: 26,260,413 N136S probably benign Het
Il10ra C A 9: 45,260,405 C255F probably damaging Het
Itgam A T 7: 128,084,942 T340S probably benign Het
Ldb2 A G 5: 44,532,665 L204P probably damaging Het
Map2k4 T C 11: 65,707,016 T90A possibly damaging Het
Mettl3 A T 14: 52,297,971 D287E probably benign Het
Mier2 A G 10: 79,544,742 F278S probably damaging Het
Mis18bp1 A G 12: 65,149,163 M609T probably benign Het
Myo1d A T 11: 80,557,512 V929D probably damaging Het
Naprt A T 15: 75,891,979 M364K probably benign Het
Nod2 T A 8: 88,670,460 C833S probably benign Het
Nrip3 C T 7: 109,763,479 probably null Het
Ntsr2 A G 12: 16,658,425 Y320C probably damaging Het
Olfr1178 C A 2: 88,391,533 C95* probably null Het
Olfr555 G A 7: 102,659,647 M275I probably benign Het
Olfr761 G A 17: 37,952,424 S200F possibly damaging Het
Osbpl3 A T 6: 50,348,083 probably null Het
Pcdhb3 C T 18: 37,301,646 R222C probably damaging Het
Pik3cd G T 4: 149,659,743 R184S probably benign Het
Rad50 A T 11: 53,669,770 probably null Het
Rad51ap2 A T 12: 11,457,559 H494L probably benign Het
Rbm25 T C 12: 83,676,089 M762T probably damaging Het
Sars G T 3: 108,428,274 S338* probably null Het
Usp35 T C 7: 97,325,948 E6G probably damaging Het
Vash2 T C 1: 190,960,225 Y251C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20 T A 12: 110,797,009 probably benign Het
Wfdc1 G A 8: 119,679,407 C87Y probably damaging Het
Zfp985 T A 4: 147,583,348 H224Q probably benign Het
Other mutations in Ktn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Ktn1 APN 14 47708878 missense probably benign 0.30
IGL01109:Ktn1 APN 14 47714721 missense probably damaging 1.00
IGL02300:Ktn1 APN 14 47690060 missense probably damaging 1.00
IGL02339:Ktn1 APN 14 47683378 splice site probably benign
IGL02525:Ktn1 APN 14 47724743 critical splice donor site probably null
IGL02565:Ktn1 APN 14 47672934 splice site probably benign
IGL02678:Ktn1 APN 14 47734153 critical splice acceptor site probably null
IGL03181:Ktn1 APN 14 47733284 missense probably benign 0.19
IGL03393:Ktn1 APN 14 47690934 missense probably damaging 1.00
PIT4520001:Ktn1 UTSW 14 47686317 missense probably damaging 0.96
R0035:Ktn1 UTSW 14 47730379 missense probably benign 0.07
R0035:Ktn1 UTSW 14 47730379 missense probably benign 0.07
R0270:Ktn1 UTSW 14 47714662 missense probably benign 0.00
R0370:Ktn1 UTSW 14 47664075 missense probably benign 0.00
R0371:Ktn1 UTSW 14 47724003 nonsense probably null
R0530:Ktn1 UTSW 14 47733243 missense probably benign 0.14
R0531:Ktn1 UTSW 14 47663941 missense probably damaging 0.98
R0611:Ktn1 UTSW 14 47694616 missense probably benign
R0836:Ktn1 UTSW 14 47701062 splice site probably null
R1076:Ktn1 UTSW 14 47694638 missense probably damaging 0.99
R1522:Ktn1 UTSW 14 47667416 missense probably damaging 1.00
R1554:Ktn1 UTSW 14 47695507 missense probably damaging 1.00
R1992:Ktn1 UTSW 14 47695521 missense probably damaging 1.00
R2040:Ktn1 UTSW 14 47700612 splice site probably benign
R2080:Ktn1 UTSW 14 47725960 missense probably damaging 1.00
R2110:Ktn1 UTSW 14 47693888 missense possibly damaging 0.47
R2144:Ktn1 UTSW 14 47714652 missense probably damaging 1.00
R3730:Ktn1 UTSW 14 47701149 missense probably damaging 1.00
R3780:Ktn1 UTSW 14 47706403 splice site probably benign
R3782:Ktn1 UTSW 14 47706403 splice site probably benign
R4414:Ktn1 UTSW 14 47724930 nonsense probably null
R4610:Ktn1 UTSW 14 47726179 intron probably benign
R4784:Ktn1 UTSW 14 47693496 critical splice donor site probably null
R4838:Ktn1 UTSW 14 47725956 nonsense probably null
R4909:Ktn1 UTSW 14 47706460 missense probably damaging 0.99
R4976:Ktn1 UTSW 14 47670299 critical splice donor site probably null
R5110:Ktn1 UTSW 14 47704287 splice site probably benign
R5257:Ktn1 UTSW 14 47667363 missense probably benign 0.05
R5469:Ktn1 UTSW 14 47690920 missense probably damaging 1.00
R5600:Ktn1 UTSW 14 47690033 missense probably damaging 1.00
R5607:Ktn1 UTSW 14 47734097 intron probably benign
R5608:Ktn1 UTSW 14 47734097 intron probably benign
R5920:Ktn1 UTSW 14 47724024 nonsense probably null
R6045:Ktn1 UTSW 14 47676796 missense probably damaging 1.00
R6139:Ktn1 UTSW 14 47726215 splice site probably null
R6654:Ktn1 UTSW 14 47690000 missense probably damaging 1.00
R6957:Ktn1 UTSW 14 47667353 nonsense probably null
R6959:Ktn1 UTSW 14 47720256 missense probably damaging 1.00
R7170:Ktn1 UTSW 14 47706410 missense probably damaging 1.00
R7206:Ktn1 UTSW 14 47695528 missense probably damaging 0.97
R7442:Ktn1 UTSW 14 47714640 missense probably benign 0.01
R7462:Ktn1 UTSW 14 47694632 missense probably null 1.00
R7513:Ktn1 UTSW 14 47664084 missense possibly damaging 0.77
R7743:Ktn1 UTSW 14 47670293 missense probably damaging 1.00
R8010:Ktn1 UTSW 14 47705773 missense possibly damaging 0.60
R8062:Ktn1 UTSW 14 47724972 critical splice donor site probably null
Z1177:Ktn1 UTSW 14 47692438 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACGAGTCAACGTATTTTGTTGTCC -3'
(R):5'- CCTGGGATCTTTGATGCATCAC -3'

Sequencing Primer
(F):5'- AGTCAACGTATTTTGTTGTCCTCATC -3'
(R):5'- GATGACCTGCTCTTCAAGGG -3'
Posted On2018-03-15