Incidental Mutation 'R6282:Rad51ap2'
ID508011
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene NameRAD51 associated protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6282 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location11456079-11462928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11457559 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 494 (H494L)
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
Predicted Effect probably benign
Transcript: ENSMUST00000124065
AA Change: H494L

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022
AA Change: H494L

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,800,769 L185Q possibly damaging Het
Abca6 A T 11: 110,208,824 C966S probably damaging Het
Atp13a4 A T 16: 29,434,004 I708N probably benign Het
Axin1 C G 17: 26,143,037 D118E probably damaging Het
Bace2 A T 16: 97,415,097 I297F probably damaging Het
C87499 T C 4: 88,630,054 E38G probably damaging Het
Ccdc30 T A 4: 119,324,017 D649V probably damaging Het
Cd180 G A 13: 102,693,757 A20T possibly damaging Het
Cdk18 T C 1: 132,120,020 D112G probably damaging Het
Cuedc1 A G 11: 88,183,402 N254S probably damaging Het
Dnah7a T C 1: 53,503,601 H2470R probably damaging Het
Drap1 G A 19: 5,424,436 probably null Het
Fam196b A G 11: 34,402,819 D287G possibly damaging Het
Fbxo5 T A 10: 5,801,216 K257M probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12790 A G 4: 101,967,516 V185A possibly damaging Het
Gm7361 A G 5: 26,260,413 N136S probably benign Het
Il10ra C A 9: 45,260,405 C255F probably damaging Het
Itgam A T 7: 128,084,942 T340S probably benign Het
Ktn1 A T 14: 47,663,971 N62I probably damaging Het
Ldb2 A G 5: 44,532,665 L204P probably damaging Het
Map2k4 T C 11: 65,707,016 T90A possibly damaging Het
Mettl3 A T 14: 52,297,971 D287E probably benign Het
Mier2 A G 10: 79,544,742 F278S probably damaging Het
Mis18bp1 A G 12: 65,149,163 M609T probably benign Het
Myo1d A T 11: 80,557,512 V929D probably damaging Het
Naprt A T 15: 75,891,979 M364K probably benign Het
Nod2 T A 8: 88,670,460 C833S probably benign Het
Nrip3 C T 7: 109,763,479 probably null Het
Ntsr2 A G 12: 16,658,425 Y320C probably damaging Het
Olfr1178 C A 2: 88,391,533 C95* probably null Het
Olfr555 G A 7: 102,659,647 M275I probably benign Het
Olfr761 G A 17: 37,952,424 S200F possibly damaging Het
Osbpl3 A T 6: 50,348,083 probably null Het
Pcdhb3 C T 18: 37,301,646 R222C probably damaging Het
Pik3cd G T 4: 149,659,743 R184S probably benign Het
Rad50 A T 11: 53,669,770 probably null Het
Rbm25 T C 12: 83,676,089 M762T probably damaging Het
Sars G T 3: 108,428,274 S338* probably null Het
Usp35 T C 7: 97,325,948 E6G probably damaging Het
Vash2 T C 1: 190,960,225 Y251C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20 T A 12: 110,797,009 probably benign Het
Wfdc1 G A 8: 119,679,407 C87Y probably damaging Het
Zfp985 T A 4: 147,583,348 H224Q probably benign Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11458138 missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11458591 missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11456929 missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11456896 missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11457197 missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11458539 missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11457042 missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11457896 missense probably benign 0.20
R0674:Rad51ap2 UTSW 12 11458817 critical splice donor site probably null
R0699:Rad51ap2 UTSW 12 11457600 missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11456251 missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11458094 missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11457112 missense probably damaging 0.99
R1746:Rad51ap2 UTSW 12 11457775 missense probably benign
R1882:Rad51ap2 UTSW 12 11456250 missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11457024 missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11457751 missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11457057 missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11457108 missense probably benign
R2393:Rad51ap2 UTSW 12 11457797 missense probably damaging 0.98
R2407:Rad51ap2 UTSW 12 11458501 missense probably damaging 0.99
R2518:Rad51ap2 UTSW 12 11457067 missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11457184 missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11456757 missense possibly damaging 0.53
R4009:Rad51ap2 UTSW 12 11457051 missense probably benign 0.33
R4108:Rad51ap2 UTSW 12 11458395 missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11456464 missense probably benign 0.01
R4536:Rad51ap2 UTSW 12 11457849 missense possibly damaging 0.90
R4594:Rad51ap2 UTSW 12 11457880 missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11456551 missense probably damaging 0.96
R4679:Rad51ap2 UTSW 12 11456551 missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11457405 missense probably damaging 1.00
R5151:Rad51ap2 UTSW 12 11457515 missense probably benign 0.09
R5421:Rad51ap2 UTSW 12 11459367 nonsense probably null
R5517:Rad51ap2 UTSW 12 11458312 missense probably benign 0.19
R5786:Rad51ap2 UTSW 12 11456920 missense probably damaging 1.00
R5884:Rad51ap2 UTSW 12 11457533 small deletion probably benign
R5932:Rad51ap2 UTSW 12 11458386 missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11458522 missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11457417 missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11457289 missense probably benign 0.01
R6235:Rad51ap2 UTSW 12 11457516 missense possibly damaging 0.70
R6488:Rad51ap2 UTSW 12 11458160 missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11457646 missense probably benign 0.17
R6759:Rad51ap2 UTSW 12 11457144 missense possibly damaging 0.91
R7030:Rad51ap2 UTSW 12 11457431 missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11456365 missense probably benign
R7105:Rad51ap2 UTSW 12 11458277 missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11456806 missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11457691 missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11457343 missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11457981 missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11457115 missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11456655 missense probably benign
R7839:Rad51ap2 UTSW 12 11457237 missense possibly damaging 0.83
R7916:Rad51ap2 UTSW 12 11456655 missense probably benign
R7922:Rad51ap2 UTSW 12 11457237 missense possibly damaging 0.83
RF023:Rad51ap2 UTSW 12 11458075 missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11458096 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCAAAACTTGGACTGTGACAGATC -3'
(R):5'- GTAGTTTGGCACATCTTGTACTCTC -3'

Sequencing Primer
(F):5'- ACTTGGACTGTGACAGATCTATTTTG -3'
(R):5'- GGCACATCTTGTACTCTCATAACTAG -3'
Posted On2018-03-15