Incidental Mutation 'FR4304:Med12l'
ID 510971
Institutional Source Beutler Lab
Gene Symbol Med12l
Ensembl Gene ENSMUSG00000056476
Gene Name mediator complex subunit 12-like
Synonyms
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.257) question?
Stock # FR4304 ()
Quality Score 183.468
Status Not validated
Chromosome 3
Chromosomal Location 58913246-59226103 bp(+) (GRCm39)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) AGC to AGCGGC at 59183403 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000164225] [ENSMUST00000199659]
AlphaFold Q8BQM9
Predicted Effect probably benign
Transcript: ENSMUST00000040325
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164225
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199400
Predicted Effect probably benign
Transcript: ENSMUST00000199659
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 137 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik CTT CTTTTT 12: 110,634,883 (GRCm39) probably benign Homo
1700001K19Rik TTC TTCGTC 12: 110,634,884 (GRCm39) probably benign Homo
4930433I11Rik ACCTC AC 7: 40,642,480 (GRCm39) probably benign Het
4930447C04Rik AAGT A 12: 72,928,061 (GRCm39) probably benign Homo
Acbd4 CAG CAGACTAG 11: 102,994,931 (GRCm39) probably null Homo
Ahdc1 CT CTCTT 4: 132,790,070 (GRCm39) probably benign Homo
Alpk3 TCT TCTGCT 7: 80,727,510 (GRCm39) probably benign Het
Anapc4 C T 5: 53,021,868 (GRCm39) T650M probably damaging Homo
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,693,977 (GRCm39) probably benign Het
Ankrd35 TAGC TAGCAGC 3: 96,591,163 (GRCm39) probably benign Homo
Apc GCCAATAAA GCCAATAAAACCAATAAA 18: 34,415,050 (GRCm39) probably benign Het
Apol6 TTGT TTGTCTGT 15: 76,935,636 (GRCm39) probably null Het
Arhgap30 TGGCCC TGGCCCTGGCCCAGGCCTTGGCCCCGGCCC 1: 171,232,736 (GRCm39) probably benign Het
Arpc1b GCC GCCTGTCC 5: 145,063,601 (GRCm39) probably null Het
Blm CT CTACGT 7: 80,113,521 (GRCm39) probably null Homo
Blm TCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCC 7: 80,162,667 (GRCm39) probably benign Het
Btnl10 GA GAATA 11: 58,814,756 (GRCm39) probably benign Homo
Cacna1f AGG AGGCGG X: 7,486,300 (GRCm39) probably benign Het
Calhm3 CG CGG 19: 47,140,335 (GRCm39) probably null Homo
Catsper2 C CTTTTACTTTTTA 2: 121,228,023 (GRCm39) probably null Homo
Catsper2 CAT CATTAT 2: 121,228,263 (GRCm39) probably benign Het
Ccdc121 GAGAAG GAG 5: 31,644,717 (GRCm39) probably benign Homo
Ccdc15 AC ACTTTCC 9: 37,226,453 (GRCm39) probably null Het
Ccdc162 T C 10: 41,432,117 (GRCm39) D1792G possibly damaging Het
Ccdc170 CCA CCATCA 10: 4,511,021 (GRCm39) probably benign Het
Ccdc73 TAAG T 2: 104,822,185 (GRCm39) probably benign Homo
Ccdc85c GCC GCCCCC 12: 108,240,871 (GRCm39) probably benign Het
Cd22 C T 7: 30,577,507 (GRCm39) R2H possibly damaging Het
Cd80 AGA AGAGGA 16: 38,306,677 (GRCm39) probably benign Homo
Cep89 GACT G 7: 35,109,066 (GRCm39) probably benign Het
Cfap74 A G 4: 155,500,217 (GRCm39) D21G possibly damaging Homo
Cgref1 T TCTA 5: 31,091,124 (GRCm39) probably benign Homo
Chd4 GCC GCCACTCCC 6: 125,099,107 (GRCm39) probably benign Het
Cnpy3 TCC TCCCCC 17: 47,047,669 (GRCm39) probably benign Het
Cnpy3 TCC TCCACC 17: 47,047,672 (GRCm39) probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,080,407 (GRCm39) probably benign Het
Cntnap1 CCCCAG CCCCAGACCCAG 11: 101,080,415 (GRCm39) probably benign Het
Col2a1 C A 15: 97,886,862 (GRCm39) probably null Homo
Cpeb4 T TGA 11: 31,877,638 (GRCm39) probably benign Homo
Cpne1 AGA AGAGAGA 2: 155,913,945 (GRCm39) probably null Homo
Cttnbp2 ATTGCTG ATTGCTGTTGCTG 6: 18,367,457 (GRCm39) probably benign Het
Dhx37 CTGG C 5: 125,504,594 (GRCm39) probably benign Het
Dhx8 CGAGAC CGAGACGGAGAC 11: 101,629,014 (GRCm39) probably benign Homo
Dnaaf9 TCC TCCCCC 2: 130,612,668 (GRCm39) probably benign Het
Dnah12 G T 14: 26,571,342 (GRCm39) G2817V probably damaging Homo
Dst C A 1: 34,240,045 (GRCm39) S1798Y probably damaging Het
Eif3a TA TATTTCA 19: 60,763,728 (GRCm39) probably benign Homo
Ermn TTC TTCCTC 2: 57,938,090 (GRCm39) probably benign Het
Ermn CTT CTTGTT 2: 57,938,098 (GRCm39) probably benign Het
Fbxo43 TGTGCC TGTGCCAGTGCC 15: 36,152,243 (GRCm39) probably benign Het
Fbxo43 GCCTGT GCCTGTCCCTGT 15: 36,152,246 (GRCm39) probably benign Het
Fbxo43 GCCTGT GCCTGTTCCTGT 15: 36,152,240 (GRCm39) probably benign Het
Fmn1 TCC TCCTCCACC 2: 113,356,128 (GRCm39) probably benign Homo
Fmn1 TCCTCC TCCTCCCCCTCC 2: 113,356,119 (GRCm39) probably benign Het
Foxd3 GGACCCTACGGCCG GG 4: 99,545,633 (GRCm39) probably benign Homo
Frmpd2 G T 14: 33,232,978 (GRCm39) L399F probably damaging Homo
Gabre ACTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC ACTCCGGCTCCGGCTCCGGCTCAGGCTCAGGCTCCGGCTCAGGCTCCGGCTCCGGCTCCGGCTC X: 71,313,648 (GRCm39) probably benign Homo
Gbp2b A G 3: 142,309,413 (GRCm39) I175V probably benign Het
Gm4340 CAG CAGAAG 10: 104,031,933 (GRCm39) probably benign Het
Gm4340 AGC AGCGGC 10: 104,031,943 (GRCm39) probably benign Het
Gm5114 T C 7: 39,060,529 (GRCm39) R107G probably benign Het
Gm5114 A C 7: 39,060,530 (GRCm39) H106Q probably benign Het
H1f6 GAGAA GA 13: 23,879,903 (GRCm39) probably benign Homo
H2-Q4 G A 17: 35,599,381 (GRCm39) D155N probably damaging Het
H2-T10 TGTTTCCCACTG T 17: 36,431,173 (GRCm39) probably null Het
Ifi203 C T 1: 173,755,894 (GRCm39) probably benign Het
Ifi208 ATGGTG ATG 1: 173,505,264 (GRCm39) probably benign Homo
Ighv5-9 C T 12: 113,625,497 (GRCm39) S82N probably benign Homo
Il17rd CGG CGGTGG 14: 26,804,637 (GRCm39) probably benign Het
Il2 AGTGG AGTGGGGCTTGAGGTGG 3: 37,179,975 (GRCm39) probably benign Het
Ipo9 TCC TCCGCC 1: 135,314,013 (GRCm39) probably benign Het
Ipo9 CCT CCTACT 1: 135,314,017 (GRCm39) probably null Het
Isg20l2 AAG AAGCAG 3: 87,839,019 (GRCm39) probably benign Homo
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,285,788 (GRCm39) probably benign Het
Kmt2c TGCTGCTG TGCTGCTGCTGCTG 5: 25,520,764 (GRCm39) probably benign Homo
Krt10 CGCC CGCCGCC 11: 99,277,025 (GRCm39) probably benign Het
Krt10 CCTCCT CCTCCTACTCCT 11: 99,280,100 (GRCm39) probably benign Het
Las1l GAG GAGCAG X: 94,984,426 (GRCm39) probably benign Het
Las1l AGG AGGCGG X: 94,984,427 (GRCm39) probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCATCTCCAGCTCCAGCTCCAGCTCCA 2: 181,339,372 (GRCm39) probably benign Het
Lrch1 A T 14: 75,057,005 (GRCm39) C241S possibly damaging Het
Lrit3 G GCTT 3: 129,582,468 (GRCm39) probably benign Het
Maml2 GCAGCAGCAACAGCAGCA GCAGCAGCA 9: 13,532,755 (GRCm39) probably benign Homo
Mast4 T TTTC 13: 102,871,370 (GRCm39) probably benign Het
Muc21 T G 17: 35,933,013 (GRCm39) probably benign Homo
Noc2l TGC TGCAGC 4: 156,324,553 (GRCm39) probably benign Het
Nrg3 G GACATTT 14: 38,119,230 (GRCm39) probably benign Homo
Or51q1 TCC TCCC 7: 103,629,110 (GRCm39) probably null Het
Padi3 TCTCAC TC 4: 140,520,283 (GRCm39) probably benign Homo
Patl2 GCT GCTTCT 2: 121,956,616 (GRCm39) probably benign Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,006,685 (GRCm39) probably null Homo
Pik3c2g AG AGAGGG 6: 139,612,654 (GRCm39) probably null Homo
Plekhs1 T TTCAGACCTCCCC 19: 56,468,290 (GRCm39) probably benign Het
Prkd3 G T 17: 79,283,249 (GRCm39) probably null Homo
Prkn G A 17: 12,073,650 (GRCm39) V323M probably damaging Het
Prr13 TCC TCCCCC 15: 102,370,612 (GRCm39) probably benign Homo
Prrc2b G A 2: 32,111,179 (GRCm39) A1852T probably damaging Homo
Ptms CTT CTTTTT 6: 124,891,421 (GRCm39) probably benign Homo
Rtl1 TTCCTCTTCCTCCTC TTCCTC 12: 109,557,632 (GRCm39) probably benign Homo
Scaf4 TGCGGC TGC 16: 90,026,742 (GRCm39) probably benign Homo
Serac1 T A 17: 6,121,083 (GRCm39) K70N probably damaging Homo
Six3 CGG CGGTGG 17: 85,928,796 (GRCm39) probably benign Het
Sry GTG GTGCTG Y: 2,662,837 (GRCm39) probably benign Homo
Stard8 GGAAGA GGAAGAAGA X: 98,110,111 (GRCm39) probably benign Het
Supt20 TTCAGCA TTCAGCATCAGCA 3: 54,635,068 (GRCm39) probably benign Het
Supt20 CAGCAG CAGCAGTAGCAG 3: 54,635,085 (GRCm39) probably null Het
Supt20 AGCAGC AGCAGCGGCAGC 3: 54,635,083 (GRCm39) probably benign Het
Sytl1 CTCT C 4: 132,984,304 (GRCm39) probably benign Homo
Tcof1 AGC AGCGGC 18: 60,968,814 (GRCm39) probably benign Het
Tdpoz2 T TCA 3: 93,558,922 (GRCm39) probably null Homo
Tert GCC GCCAAGGGTTCC 13: 73,796,421 (GRCm39) probably benign Homo
Tfeb GCA GCAACA 17: 48,097,019 (GRCm39) probably benign Het
Ticrr ATT ATTTTT 7: 79,344,059 (GRCm39) probably benign Homo
Tnfaip8 ACACACACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC AC 18: 50,179,906 (GRCm39) probably null Homo
Tnfrsf9 T TGCC 4: 151,018,852 (GRCm39) probably benign Homo
Tob1 GCA GCAACA 11: 94,105,290 (GRCm39) probably benign Het
Tob1 CA CAGTA 11: 94,105,303 (GRCm39) probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,887,207 (GRCm39) probably benign Homo
Triobp TCGTCG TCGTCGTCG 15: 78,877,587 (GRCm39) probably benign Homo
Tsbp1 A AGCC 17: 34,679,029 (GRCm39) probably benign Het
Tsbp1 GC GCATC 17: 34,679,051 (GRCm39) probably benign Het
Tsen2 AGG AGGGGG 6: 115,537,030 (GRCm39) probably benign Het
Ubtf TCC TCCGCC 11: 102,197,782 (GRCm39) probably benign Het
Ubtf CTCGTCGTC CTCGTCGTCGTC 11: 102,197,784 (GRCm39) probably benign Het
Vars1 TGG TGGAGTCCTGGGCGG 17: 35,234,965 (GRCm39) probably benign Homo
Vmn1r171 C T 7: 23,332,105 (GRCm39) A110V probably benign Het
Vmn2r31 G T 7: 7,387,607 (GRCm39) Q655K probably damaging Het
Vmn2r87 C T 10: 130,314,583 (GRCm39) M334I probably benign Homo
Zc3h13 CG CGAGATGTGTG 14: 75,561,050 (GRCm39) probably benign Het
Zc3h13 AGATGTGCG AGATGTGCGGGATGTGCG 14: 75,561,043 (GRCm39) probably benign Het
Zfp282 GGC GGCCGC 6: 47,881,731 (GRCm39) probably benign Het
Zfp384 AGGC AGGCCCAGGCCCCGGC 6: 125,013,456 (GRCm39) probably benign Het
Zfp459 TGA TGAGCGA 13: 67,556,393 (GRCm39) probably null Homo
Zfp462 GCCACC GCCACCTCAGCCACAACCACC 4: 55,009,757 (GRCm39) probably benign Het
Zfp462 CCACC CCACCTCAGCCACAGTCACC 4: 55,009,758 (GRCm39) probably benign Het
Zfp598 CACCAC CACCACAACCAC 17: 24,899,749 (GRCm39) probably benign Het
Zfp831 CCT CCTGCT 2: 174,487,274 (GRCm39) probably benign Het
Other mutations in Med12l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Med12l APN 3 58,949,757 (GRCm39) missense probably damaging 0.98
IGL00561:Med12l APN 3 59,135,245 (GRCm39) missense probably benign
IGL00974:Med12l APN 3 58,990,435 (GRCm39) missense probably damaging 1.00
IGL01024:Med12l APN 3 58,980,762 (GRCm39) missense probably damaging 1.00
IGL01094:Med12l APN 3 59,001,076 (GRCm39) missense probably damaging 0.99
IGL01134:Med12l APN 3 58,949,696 (GRCm39) missense possibly damaging 0.91
IGL01535:Med12l APN 3 59,169,680 (GRCm39) missense probably damaging 1.00
IGL01653:Med12l APN 3 59,169,314 (GRCm39) missense probably damaging 1.00
IGL01735:Med12l APN 3 59,170,675 (GRCm39) missense probably damaging 1.00
IGL01972:Med12l APN 3 59,169,314 (GRCm39) missense probably damaging 1.00
IGL02005:Med12l APN 3 59,152,368 (GRCm39) missense probably damaging 1.00
IGL02098:Med12l APN 3 59,183,276 (GRCm39) missense possibly damaging 0.92
IGL02115:Med12l APN 3 58,975,740 (GRCm39) missense probably benign 0.00
IGL02231:Med12l APN 3 59,153,303 (GRCm39) missense probably damaging 1.00
IGL02259:Med12l APN 3 59,153,264 (GRCm39) missense probably damaging 1.00
IGL02369:Med12l APN 3 59,164,794 (GRCm39) missense probably benign 0.00
IGL02424:Med12l APN 3 59,000,143 (GRCm39) missense probably benign 0.21
IGL02501:Med12l APN 3 59,169,397 (GRCm39) missense possibly damaging 0.71
IGL02525:Med12l APN 3 58,975,789 (GRCm39) missense probably benign 0.01
IGL02530:Med12l APN 3 58,984,510 (GRCm39) missense probably damaging 1.00
IGL02735:Med12l APN 3 59,001,067 (GRCm39) missense probably damaging 1.00
IGL02865:Med12l APN 3 59,201,713 (GRCm39) missense probably damaging 1.00
IGL03183:Med12l APN 3 58,944,976 (GRCm39) splice site probably null
IGL03264:Med12l APN 3 59,208,788 (GRCm39) nonsense probably null
FR4340:Med12l UTSW 3 59,183,406 (GRCm39) small insertion probably benign
FR4342:Med12l UTSW 3 59,183,415 (GRCm39) small insertion probably benign
FR4342:Med12l UTSW 3 59,183,409 (GRCm39) small insertion probably benign
FR4449:Med12l UTSW 3 59,183,384 (GRCm39) nonsense probably null
FR4548:Med12l UTSW 3 59,183,403 (GRCm39) small insertion probably benign
FR4589:Med12l UTSW 3 59,183,377 (GRCm39) small insertion probably benign
FR4976:Med12l UTSW 3 59,183,398 (GRCm39) small insertion probably benign
P0007:Med12l UTSW 3 58,998,816 (GRCm39) splice site probably benign
P0045:Med12l UTSW 3 58,998,956 (GRCm39) missense probably damaging 0.99
R0030:Med12l UTSW 3 59,156,076 (GRCm39) missense probably damaging 1.00
R0030:Med12l UTSW 3 59,156,076 (GRCm39) missense probably damaging 1.00
R0148:Med12l UTSW 3 58,945,075 (GRCm39) missense probably damaging 1.00
R0325:Med12l UTSW 3 58,984,480 (GRCm39) missense possibly damaging 0.88
R0330:Med12l UTSW 3 59,135,123 (GRCm39) missense probably damaging 1.00
R0388:Med12l UTSW 3 59,000,925 (GRCm39) splice site probably benign
R0542:Med12l UTSW 3 58,949,822 (GRCm39) missense probably damaging 1.00
R0624:Med12l UTSW 3 58,945,123 (GRCm39) nonsense probably null
R0625:Med12l UTSW 3 59,154,858 (GRCm39) missense probably damaging 1.00
R0671:Med12l UTSW 3 59,172,350 (GRCm39) missense probably damaging 1.00
R0706:Med12l UTSW 3 59,169,401 (GRCm39) missense probably damaging 1.00
R0785:Med12l UTSW 3 59,168,253 (GRCm39) missense probably damaging 1.00
R1054:Med12l UTSW 3 59,156,072 (GRCm39) missense probably damaging 0.99
R1102:Med12l UTSW 3 59,152,257 (GRCm39) missense probably damaging 0.99
R1391:Med12l UTSW 3 58,945,159 (GRCm39) missense probably benign 0.00
R1501:Med12l UTSW 3 59,168,256 (GRCm39) critical splice donor site probably null
R1544:Med12l UTSW 3 59,172,661 (GRCm39) missense possibly damaging 0.71
R1662:Med12l UTSW 3 59,001,038 (GRCm39) missense probably damaging 1.00
R1670:Med12l UTSW 3 59,183,379 (GRCm39) small insertion probably benign
R1839:Med12l UTSW 3 58,975,740 (GRCm39) missense probably benign
R1854:Med12l UTSW 3 59,168,193 (GRCm39) missense probably damaging 1.00
R2045:Med12l UTSW 3 59,169,731 (GRCm39) nonsense probably null
R2070:Med12l UTSW 3 59,152,326 (GRCm39) missense probably damaging 1.00
R2132:Med12l UTSW 3 59,172,703 (GRCm39) splice site probably null
R2290:Med12l UTSW 3 59,152,359 (GRCm39) missense probably damaging 1.00
R2325:Med12l UTSW 3 59,139,875 (GRCm39) missense probably damaging 0.99
R2352:Med12l UTSW 3 59,148,113 (GRCm39) missense probably damaging 1.00
R2484:Med12l UTSW 3 59,205,259 (GRCm39) missense probably benign 0.18
R2906:Med12l UTSW 3 59,164,503 (GRCm39) missense probably damaging 1.00
R3735:Med12l UTSW 3 58,998,916 (GRCm39) missense probably damaging 1.00
R3736:Med12l UTSW 3 58,998,916 (GRCm39) missense probably damaging 1.00
R3774:Med12l UTSW 3 59,155,363 (GRCm39) missense probably damaging 0.97
R3957:Med12l UTSW 3 58,980,589 (GRCm39) missense probably damaging 0.99
R4020:Med12l UTSW 3 59,155,363 (GRCm39) missense probably damaging 0.97
R4087:Med12l UTSW 3 59,205,342 (GRCm39) missense probably benign 0.00
R4231:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4233:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4235:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4236:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4327:Med12l UTSW 3 59,172,688 (GRCm39) missense probably benign 0.01
R4328:Med12l UTSW 3 59,172,688 (GRCm39) missense probably benign 0.01
R4346:Med12l UTSW 3 58,938,976 (GRCm39) missense probably damaging 1.00
R4543:Med12l UTSW 3 58,998,929 (GRCm39) missense probably damaging 1.00
R4559:Med12l UTSW 3 58,914,523 (GRCm39) critical splice donor site probably null
R4776:Med12l UTSW 3 59,140,633 (GRCm39) missense probably damaging 1.00
R4877:Med12l UTSW 3 59,152,214 (GRCm39) missense probably damaging 1.00
R4983:Med12l UTSW 3 59,169,350 (GRCm39) missense probably damaging 1.00
R5114:Med12l UTSW 3 59,167,109 (GRCm39) missense possibly damaging 0.85
R5125:Med12l UTSW 3 59,174,635 (GRCm39) missense possibly damaging 0.83
R5230:Med12l UTSW 3 59,153,209 (GRCm39) missense probably damaging 1.00
R5407:Med12l UTSW 3 59,165,622 (GRCm39) missense probably damaging 1.00
R5426:Med12l UTSW 3 59,156,143 (GRCm39) missense probably damaging 0.98
R5439:Med12l UTSW 3 59,170,634 (GRCm39) missense probably null 1.00
R5449:Med12l UTSW 3 59,167,127 (GRCm39) missense probably damaging 1.00
R5596:Med12l UTSW 3 59,159,771 (GRCm39) missense probably benign 0.45
R5716:Med12l UTSW 3 59,208,798 (GRCm39) critical splice donor site probably null
R5833:Med12l UTSW 3 59,172,647 (GRCm39) missense possibly damaging 0.95
R5883:Med12l UTSW 3 58,998,889 (GRCm39) missense probably damaging 1.00
R6264:Med12l UTSW 3 59,163,423 (GRCm39) missense probably damaging 1.00
R6269:Med12l UTSW 3 59,135,243 (GRCm39) missense probably damaging 1.00
R6394:Med12l UTSW 3 59,142,508 (GRCm39) missense probably damaging 1.00
R6400:Med12l UTSW 3 59,155,332 (GRCm39) missense probably damaging 1.00
R6475:Med12l UTSW 3 59,164,500 (GRCm39) missense probably damaging 1.00
R6489:Med12l UTSW 3 59,164,828 (GRCm39) missense probably damaging 0.99
R6654:Med12l UTSW 3 59,169,713 (GRCm39) missense probably damaging 1.00
R6881:Med12l UTSW 3 59,174,586 (GRCm39) missense probably benign 0.00
R7110:Med12l UTSW 3 59,169,645 (GRCm39) missense possibly damaging 0.92
R7134:Med12l UTSW 3 59,001,180 (GRCm39) nonsense probably null
R7137:Med12l UTSW 3 59,165,675 (GRCm39) missense probably damaging 1.00
R7159:Med12l UTSW 3 59,183,438 (GRCm39) missense probably benign
R7341:Med12l UTSW 3 58,949,824 (GRCm39) missense possibly damaging 0.53
R7349:Med12l UTSW 3 59,165,746 (GRCm39) missense probably damaging 1.00
R7413:Med12l UTSW 3 58,998,971 (GRCm39) missense probably benign 0.00
R7495:Med12l UTSW 3 59,152,194 (GRCm39) missense probably damaging 1.00
R7678:Med12l UTSW 3 58,984,141 (GRCm39) missense probably damaging 1.00
R7697:Med12l UTSW 3 59,148,078 (GRCm39) missense probably damaging 1.00
R7714:Med12l UTSW 3 59,001,007 (GRCm39) missense probably benign 0.17
R7725:Med12l UTSW 3 59,163,413 (GRCm39) missense probably damaging 1.00
R7846:Med12l UTSW 3 59,172,355 (GRCm39) missense probably damaging 1.00
R7852:Med12l UTSW 3 59,155,332 (GRCm39) missense probably damaging 1.00
R8080:Med12l UTSW 3 59,172,607 (GRCm39) missense probably damaging 1.00
R8181:Med12l UTSW 3 59,169,389 (GRCm39) missense probably damaging 1.00
R8223:Med12l UTSW 3 58,993,784 (GRCm39) missense possibly damaging 0.79
R8560:Med12l UTSW 3 58,945,026 (GRCm39) missense probably damaging 1.00
R8708:Med12l UTSW 3 59,159,751 (GRCm39) missense probably benign 0.00
R8865:Med12l UTSW 3 58,979,303 (GRCm39) missense probably benign
R8947:Med12l UTSW 3 58,984,443 (GRCm39) splice site probably benign
R8976:Med12l UTSW 3 59,183,329 (GRCm39) missense probably damaging 0.99
R9016:Med12l UTSW 3 59,163,294 (GRCm39) missense probably damaging 0.96
R9183:Med12l UTSW 3 58,984,498 (GRCm39) missense probably damaging 1.00
R9487:Med12l UTSW 3 59,155,353 (GRCm39) missense probably benign
R9526:Med12l UTSW 3 58,984,207 (GRCm39) missense probably damaging 0.96
R9802:Med12l UTSW 3 59,169,346 (GRCm39) missense probably damaging 1.00
RF004:Med12l UTSW 3 59,183,390 (GRCm39) small insertion probably benign
RF011:Med12l UTSW 3 59,183,401 (GRCm39) small insertion probably benign
RF013:Med12l UTSW 3 59,183,387 (GRCm39) small insertion probably benign
RF020:Med12l UTSW 3 59,183,379 (GRCm39) small insertion probably benign
RF021:Med12l UTSW 3 58,980,711 (GRCm39) missense probably benign 0.19
RF027:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF027:Med12l UTSW 3 59,183,388 (GRCm39) small insertion probably benign
RF030:Med12l UTSW 3 59,183,410 (GRCm39) small insertion probably benign
RF032:Med12l UTSW 3 59,183,410 (GRCm39) small insertion probably benign
RF032:Med12l UTSW 3 59,183,406 (GRCm39) small insertion probably benign
RF032:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF033:Med12l UTSW 3 59,183,416 (GRCm39) small insertion probably benign
RF033:Med12l UTSW 3 59,183,408 (GRCm39) small insertion probably benign
RF033:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF037:Med12l UTSW 3 59,183,377 (GRCm39) small insertion probably benign
RF040:Med12l UTSW 3 59,183,388 (GRCm39) small insertion probably benign
RF040:Med12l UTSW 3 59,183,410 (GRCm39) small insertion probably benign
RF041:Med12l UTSW 3 59,183,416 (GRCm39) small insertion probably benign
RF041:Med12l UTSW 3 59,183,406 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,388 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,377 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,416 (GRCm39) small insertion probably benign
RF049:Med12l UTSW 3 59,183,390 (GRCm39) small insertion probably benign
RF050:Med12l UTSW 3 59,183,394 (GRCm39) small insertion probably benign
RF053:Med12l UTSW 3 59,183,414 (GRCm39) small insertion probably benign
RF055:Med12l UTSW 3 59,183,404 (GRCm39) small insertion probably benign
RF056:Med12l UTSW 3 59,183,414 (GRCm39) small insertion probably benign
RF057:Med12l UTSW 3 59,183,401 (GRCm39) small insertion probably benign
RF063:Med12l UTSW 3 59,183,394 (GRCm39) small insertion probably benign
RF063:Med12l UTSW 3 59,183,379 (GRCm39) small insertion probably benign
X0062:Med12l UTSW 3 59,140,600 (GRCm39) missense probably damaging 1.00
Z1176:Med12l UTSW 3 59,203,538 (GRCm39) missense probably benign 0.00
Z1176:Med12l UTSW 3 59,152,364 (GRCm39) missense probably damaging 1.00
Z1176:Med12l UTSW 3 58,998,838 (GRCm39) missense probably damaging 0.98
Z1177:Med12l UTSW 3 59,155,296 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAGGTGGCTCCCGATTG -3'
(R):5'- GAGAGTCCTTAGCACTTTGGGC -3'

Sequencing Primer
(F):5'- TCCCGATTGGACCCTGC -3'
(R):5'- GGGCTTCTTCCCAAGATCAATAATG -3'
Posted On 2018-04-05