Mutagenetix > Incidental Mutation

Incidental Mutation 'RF063:Med12l'

605452

Institutional Source

Beutler Lab

Gene Symbol

Med12l

Ensembl Gene

ENSMUSG00000056476

Gene Name

mediator complex subunit 12-like

Synonyms

Accession Numbers

NCBI RefSeq: NM_177855.3; MGI: 2139916

Essential gene?

Possibly non essential (E-score: 0.405) question?

Stock #

RF063 (G1)

Quality Score

190.468

Status

Not validated

Chromosome

Chromosomal Location

59005825-59318682 bp(+) (GRCm38)

Type of Mutation

small insertion (1 aa in frame mutation)

DNA Base Change (assembly)

AGC to AGCCGC at 59275973 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000142903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000164225] [ENSMUST00000199659]

AlphaFold

Q8BQM9

Predicted Effect

probably benign
Transcript: ENSMUST00000040325

SMART Domains

Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	282	730	2.6e-207	PFAM
low complexity region	744	758	N/A	INTRINSIC
low complexity region	853	872	N/A	INTRINSIC
low complexity region	1455	1466	N/A	INTRINSIC
low complexity region	1728	1742	N/A	INTRINSIC
low complexity region	1769	1783	N/A	INTRINSIC
Pfam:Med12-PQL	1803	2029	2.3e-14	PFAM
low complexity region	2055	2076	N/A	INTRINSIC
low complexity region	2083	2101	N/A	INTRINSIC
low complexity region	2116	2136	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164225

SMART Domains

Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	283	765	5e-187	PFAM
low complexity region	779	793	N/A	INTRINSIC
low complexity region	888	907	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1763	1777	N/A	INTRINSIC
low complexity region	1804	1818	N/A	INTRINSIC
Pfam:Med12-PQL	1840	2063	9.7e-66	PFAM
low complexity region	2090	2111	N/A	INTRINSIC
low complexity region	2118	2136	N/A	INTRINSIC
low complexity region	2151	2171	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197374

Predicted Effect

probably benign
Transcript: ENSMUST00000199659

SMART Domains

Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	282	765	5.5e-209	PFAM
low complexity region	779	793	N/A	INTRINSIC
low complexity region	888	907	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1761	1775	N/A	INTRINSIC
low complexity region	1802	1816	N/A	INTRINSIC
Pfam:Med12-PQL	1836	2062	1.7e-15	PFAM
low complexity region	2088	2130	N/A	INTRINSIC
low complexity region	2144	2164	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.3%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 25 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430401F13Rik	CAGAAAGGAAAAGGTGGCCAG	CAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG	6: 131,552,883		probably benign	Het
5430401F13Rik	AGAAAGGAAAAGGTGGCCAG	AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG	6: 131,552,884		probably benign	Het
Abca2	G	T	2: 25,447,397	E2421D	probably damaging	Het
Apc	A	AATAAAGCCC	18: 34,282,009		probably benign	Het
Calhm1	TGGCTGTGGCTG	TGGCTGTGGCTGCGGCTGTGGCTG	19: 47,141,256		probably benign	Het
Casz1	CACA	C	4: 148,952,304		probably benign	Het
Dock4	GTGCCGGTGCCCGT	G	12: 40,844,399		probably null	Het
F11r	CCCCCCCCC	CCCCCCCCCCC	1: 171,461,190		probably benign	Het
Fam171b	C	CAGCAGA	2: 83,812,896		probably benign	Het
Fbrsl1	GCGTGTGCTGGT	GCGTGTGCTGGTACGTGTGCTGGT	5: 110,378,139		probably benign	Het
Fbrsl1	GTGCTGGTG	GTGCTGGTGCGTCTGCTGGTG	5: 110,378,143		probably benign	Het
Iqcf4	TCCTTTT	TCCTTTTCCTTTTCCTTGTCCTTTTCCTTTTCCTTTGCCTTTT	9: 106,570,617		probably benign	Het
Iqgap1	AGGCCACCACTGCTCACAGGTGCTGTACCT	A	7: 80,723,751		probably null	Het
Kmt2c	GCT	GCTCCT	5: 25,315,764		probably benign	Het
Lrtm1	TAGCCTCAGTGGCC	T	14: 29,021,443		probably null	Het
Rassf6	C	CTGCCTCACTCATGGTCCTGTAGAGCAATGGGGATTA	5: 90,608,942		probably null	Het
Sh3pxd2b	TGTGCC	TGTGCCCGTGCC	11: 32,423,051		probably benign	Het
Sorcs2	ATACATACATACCT	AT	5: 36,153,811		probably null	Het
Sry	TGCTGCTGCTGCTGCTG	T	Y: 2,662,595		probably null	Het
Stard8	GAG	GAGTAG	X: 99,066,524		probably null	Het
Tcof1	GATCCCCTTGGC	GATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGATATCCCCTTGGC	18: 60,833,573		probably benign	Het
Thegl	CCAG	CCAGCGATCCTCCCCAGTCCCGCAAGGTCAG	5: 77,016,426		probably benign	Het
Trappc9	GCTGCTGCTGCT	GCTGCTGCTGCTGCTTCTGCTGCTGCT	15: 72,801,320		probably benign	Het
Trappc9	CTGCTGCT	CTGCTGCTGCTGCTGTTGCTGCT	15: 72,801,324		probably benign	Het
Vmn1r74	CAGAGCCACCAAGTACCT	C	7: 11,847,140		probably null	Het

Other mutations in Med12l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Med12l	APN	3	59042336	missense	probably damaging	0.98
IGL00561:Med12l	APN	3	59227824	missense	probably benign
IGL00974:Med12l	APN	3	59083014	missense	probably damaging	1.00
IGL01024:Med12l	APN	3	59073341	missense	probably damaging	1.00
IGL01094:Med12l	APN	3	59093655	missense	probably damaging	0.99
IGL01134:Med12l	APN	3	59042275	missense	possibly damaging	0.91
IGL01535:Med12l	APN	3	59262259	missense	probably damaging	1.00
IGL01653:Med12l	APN	3	59261893	missense	probably damaging	1.00
IGL01735:Med12l	APN	3	59263254	missense	probably damaging	1.00
IGL01972:Med12l	APN	3	59261893	missense	probably damaging	1.00
IGL02005:Med12l	APN	3	59244947	missense	probably damaging	1.00
IGL02098:Med12l	APN	3	59275855	missense	possibly damaging	0.92
IGL02115:Med12l	APN	3	59068319	missense	probably benign	0.00
IGL02231:Med12l	APN	3	59245882	missense	probably damaging	1.00
IGL02259:Med12l	APN	3	59245843	missense	probably damaging	1.00
IGL02369:Med12l	APN	3	59257373	missense	probably benign	0.00
IGL02424:Med12l	APN	3	59092722	missense	probably benign	0.21
IGL02501:Med12l	APN	3	59261976	missense	possibly damaging	0.71
IGL02525:Med12l	APN	3	59068368	missense	probably benign	0.01
IGL02530:Med12l	APN	3	59077089	missense	probably damaging	1.00
IGL02735:Med12l	APN	3	59093646	missense	probably damaging	1.00
IGL02865:Med12l	APN	3	59294292	missense	probably damaging	1.00
IGL03183:Med12l	APN	3	59037555	splice site	probably null
IGL03264:Med12l	APN	3	59301367	nonsense	probably null
FR4304:Med12l	UTSW	3	59275982	small insertion	probably benign
FR4340:Med12l	UTSW	3	59275985	small insertion	probably benign
FR4342:Med12l	UTSW	3	59275988	small insertion	probably benign
FR4342:Med12l	UTSW	3	59275994	small insertion	probably benign
FR4449:Med12l	UTSW	3	59275963	nonsense	probably null
FR4548:Med12l	UTSW	3	59275982	small insertion	probably benign
FR4589:Med12l	UTSW	3	59275956	small insertion	probably benign
FR4976:Med12l	UTSW	3	59275977	small insertion	probably benign
P0007:Med12l	UTSW	3	59091395	splice site	probably benign
P0045:Med12l	UTSW	3	59091535	missense	probably damaging	0.99
R0030:Med12l	UTSW	3	59248655	missense	probably damaging	1.00
R0030:Med12l	UTSW	3	59248655	missense	probably damaging	1.00
R0148:Med12l	UTSW	3	59037654	missense	probably damaging	1.00
R0325:Med12l	UTSW	3	59077059	missense	possibly damaging	0.88
R0330:Med12l	UTSW	3	59227702	missense	probably damaging	1.00
R0388:Med12l	UTSW	3	59093504	splice site	probably benign
R0542:Med12l	UTSW	3	59042401	missense	probably damaging	1.00
R0624:Med12l	UTSW	3	59037702	nonsense	probably null
R0625:Med12l	UTSW	3	59247437	missense	probably damaging	1.00
R0671:Med12l	UTSW	3	59264929	missense	probably damaging	1.00
R0706:Med12l	UTSW	3	59261980	missense	probably damaging	1.00
R0785:Med12l	UTSW	3	59260832	missense	probably damaging	1.00
R1054:Med12l	UTSW	3	59248651	missense	probably damaging	0.99
R1102:Med12l	UTSW	3	59244836	missense	probably damaging	0.99
R1391:Med12l	UTSW	3	59037738	missense	probably benign	0.00
R1501:Med12l	UTSW	3	59260835	critical splice donor site	probably null
R1544:Med12l	UTSW	3	59265240	missense	possibly damaging	0.71
R1662:Med12l	UTSW	3	59093617	missense	probably damaging	1.00
R1670:Med12l	UTSW	3	59275958	small insertion	probably benign
R1839:Med12l	UTSW	3	59068319	missense	probably benign
R1854:Med12l	UTSW	3	59260772	missense	probably damaging	1.00
R2045:Med12l	UTSW	3	59262310	nonsense	probably null
R2070:Med12l	UTSW	3	59244905	missense	probably damaging	1.00
R2132:Med12l	UTSW	3	59265282	splice site	probably null
R2290:Med12l	UTSW	3	59244938	missense	probably damaging	1.00
R2325:Med12l	UTSW	3	59232454	missense	probably damaging	0.99
R2352:Med12l	UTSW	3	59240692	missense	probably damaging	1.00
R2484:Med12l	UTSW	3	59297838	missense	probably benign	0.18
R2906:Med12l	UTSW	3	59257082	missense	probably damaging	1.00
R3735:Med12l	UTSW	3	59091495	missense	probably damaging	1.00
R3736:Med12l	UTSW	3	59091495	missense	probably damaging	1.00
R3774:Med12l	UTSW	3	59247942	missense	probably damaging	0.97
R3957:Med12l	UTSW	3	59073168	missense	probably damaging	0.99
R4020:Med12l	UTSW	3	59247942	missense	probably damaging	0.97
R4087:Med12l	UTSW	3	59297921	missense	probably benign	0.00
R4231:Med12l	UTSW	3	59257223	splice site	probably null
R4233:Med12l	UTSW	3	59257223	splice site	probably null
R4235:Med12l	UTSW	3	59257223	splice site	probably null
R4236:Med12l	UTSW	3	59257223	splice site	probably null
R4327:Med12l	UTSW	3	59265267	missense	probably benign	0.01
R4328:Med12l	UTSW	3	59265267	missense	probably benign	0.01
R4346:Med12l	UTSW	3	59031555	missense	probably damaging	1.00
R4543:Med12l	UTSW	3	59091508	missense	probably damaging	1.00
R4559:Med12l	UTSW	3	59007102	critical splice donor site	probably null
R4776:Med12l	UTSW	3	59233212	missense	probably damaging	1.00
R4877:Med12l	UTSW	3	59244793	missense	probably damaging	1.00
R4983:Med12l	UTSW	3	59261929	missense	probably damaging	1.00
R5114:Med12l	UTSW	3	59259688	missense	possibly damaging	0.85
R5125:Med12l	UTSW	3	59267214	missense	possibly damaging	0.83
R5230:Med12l	UTSW	3	59245788	missense	probably damaging	1.00
R5407:Med12l	UTSW	3	59258201	missense	probably damaging	1.00
R5426:Med12l	UTSW	3	59248722	missense	probably damaging	0.98
R5439:Med12l	UTSW	3	59263213	missense	probably null	1.00
R5449:Med12l	UTSW	3	59259706	missense	probably damaging	1.00
R5596:Med12l	UTSW	3	59252350	missense	probably benign	0.45
R5716:Med12l	UTSW	3	59301377	critical splice donor site	probably null
R5833:Med12l	UTSW	3	59265226	missense	possibly damaging	0.95
R5883:Med12l	UTSW	3	59091468	missense	probably damaging	1.00
R6264:Med12l	UTSW	3	59256002	missense	probably damaging	1.00
R6269:Med12l	UTSW	3	59227822	missense	probably damaging	1.00
R6394:Med12l	UTSW	3	59235087	missense	probably damaging	1.00
R6400:Med12l	UTSW	3	59247911	missense	probably damaging	1.00
R6475:Med12l	UTSW	3	59257079	missense	probably damaging	1.00
R6489:Med12l	UTSW	3	59257407	missense	probably damaging	0.99
R6654:Med12l	UTSW	3	59262292	missense	probably damaging	1.00
R6881:Med12l	UTSW	3	59267165	missense	probably benign	0.00
R7110:Med12l	UTSW	3	59262224	missense	possibly damaging	0.92
R7134:Med12l	UTSW	3	59093759	nonsense	probably null
R7137:Med12l	UTSW	3	59258254	missense	probably damaging	1.00
R7159:Med12l	UTSW	3	59276017	missense	probably benign
R7341:Med12l	UTSW	3	59042403	missense	possibly damaging	0.53
R7349:Med12l	UTSW	3	59258325	missense	probably damaging	1.00
R7413:Med12l	UTSW	3	59091550	missense	probably benign	0.00
R7495:Med12l	UTSW	3	59244773	missense	probably damaging	1.00
R7678:Med12l	UTSW	3	59076720	missense	probably damaging	1.00
R7697:Med12l	UTSW	3	59240657	missense	probably damaging	1.00
R7714:Med12l	UTSW	3	59093586	missense	probably benign	0.17
R7725:Med12l	UTSW	3	59255992	missense	probably damaging	1.00
R7846:Med12l	UTSW	3	59264934	missense	probably damaging	1.00
R7852:Med12l	UTSW	3	59247911	missense	probably damaging	1.00
R8080:Med12l	UTSW	3	59265186	missense	probably damaging	1.00
R8181:Med12l	UTSW	3	59261968	missense	probably damaging	1.00
R8223:Med12l	UTSW	3	59086363	missense	possibly damaging	0.79
R8560:Med12l	UTSW	3	59037605	missense	probably damaging	1.00
R8708:Med12l	UTSW	3	59252330	missense	probably benign	0.00
R8865:Med12l	UTSW	3	59071882	missense	probably benign
R8947:Med12l	UTSW	3	59077022	splice site	probably benign
R8976:Med12l	UTSW	3	59275908	missense	probably damaging	0.99
R9016:Med12l	UTSW	3	59255873	missense	probably damaging	0.96
R9183:Med12l	UTSW	3	59077077	missense	probably damaging	1.00
R9487:Med12l	UTSW	3	59247932	missense	probably benign
R9526:Med12l	UTSW	3	59076786	missense	probably damaging	0.96
R9802:Med12l	UTSW	3	59261925	missense	probably damaging	1.00
RF004:Med12l	UTSW	3	59275969	small insertion	probably benign
RF011:Med12l	UTSW	3	59275980	small insertion	probably benign
RF013:Med12l	UTSW	3	59275966	small insertion	probably benign
RF020:Med12l	UTSW	3	59275958	small insertion	probably benign
RF021:Med12l	UTSW	3	59073290	missense	probably benign	0.19
RF027:Med12l	UTSW	3	59275967	small insertion	probably benign
RF027:Med12l	UTSW	3	59275981	small insertion	probably benign
RF030:Med12l	UTSW	3	59275989	small insertion	probably benign
RF032:Med12l	UTSW	3	59275981	small insertion	probably benign
RF032:Med12l	UTSW	3	59275985	small insertion	probably benign
RF032:Med12l	UTSW	3	59275989	small insertion	probably benign
RF033:Med12l	UTSW	3	59275981	small insertion	probably benign
RF033:Med12l	UTSW	3	59275987	small insertion	probably benign
RF033:Med12l	UTSW	3	59275995	small insertion	probably benign
RF037:Med12l	UTSW	3	59275956	small insertion	probably benign
RF040:Med12l	UTSW	3	59275967	small insertion	probably benign
RF040:Med12l	UTSW	3	59275989	small insertion	probably benign
RF041:Med12l	UTSW	3	59275985	small insertion	probably benign
RF041:Med12l	UTSW	3	59275995	small insertion	probably benign
RF042:Med12l	UTSW	3	59275956	small insertion	probably benign
RF042:Med12l	UTSW	3	59275967	small insertion	probably benign
RF042:Med12l	UTSW	3	59275981	small insertion	probably benign
RF042:Med12l	UTSW	3	59275995	small insertion	probably benign
RF049:Med12l	UTSW	3	59275969	small insertion	probably benign
RF050:Med12l	UTSW	3	59275973	small insertion	probably benign
RF053:Med12l	UTSW	3	59275993	small insertion	probably benign
RF055:Med12l	UTSW	3	59275983	small insertion	probably benign
RF056:Med12l	UTSW	3	59275993	small insertion	probably benign
RF057:Med12l	UTSW	3	59275980	small insertion	probably benign
RF063:Med12l	UTSW	3	59275958	small insertion	probably benign
X0062:Med12l	UTSW	3	59233179	missense	probably damaging	1.00
Z1176:Med12l	UTSW	3	59091417	missense	probably damaging	0.98
Z1176:Med12l	UTSW	3	59244943	missense	probably damaging	1.00
Z1176:Med12l	UTSW	3	59296117	missense	probably benign	0.00
Z1177:Med12l	UTSW	3	59247875	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTGGAAGAATACCTGCTGC -3'
(R):5'- TCGCAAACCTGTATAACACATG -3'

Sequencing Primer
(F):5'- CCTGGAAGAATACCTGCTGCATTTG -3'
(R):5'- CATGTACAGAGATATGCACATAGC -3'

Posted On

2019-12-04