Incidental Mutation 'R6407:Tor4a'
ID514482
Institutional Source Beutler Lab
Gene Symbol Tor4a
Ensembl Gene ENSMUSG00000059555
Gene Nametorsin family 4, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R6407 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25192966-25196886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25194940 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 317 (L317P)
Ref Sequence ENSEMBL: ENSMUSP00000080548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059849] [ENSMUST00000081869] [ENSMUST00000137920] [ENSMUST00000142857]
Predicted Effect probably benign
Transcript: ENSMUST00000059849
SMART Domains Protein: ENSMUSP00000057731
Gene: ENSMUSG00000013465

DomainStartEndE-ValueType
Pfam:COBRA1 107 578 3.5e-248 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081869
AA Change: L317P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080548
Gene: ENSMUSG00000059555
AA Change: L317P

DomainStartEndE-ValueType
low complexity region 21 40 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 81 93 N/A INTRINSIC
AAA 181 317 3.74e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128876
Predicted Effect probably benign
Transcript: ENSMUST00000137920
Predicted Effect probably benign
Transcript: ENSMUST00000142857
SMART Domains Protein: ENSMUSP00000142048
Gene: ENSMUSG00000059555

DomainStartEndE-ValueType
Pfam:Torsin 1 86 4.2e-9 PFAM
Pfam:AAA_22 12 112 6.7e-8 PFAM
Pfam:AAA_17 18 111 2.4e-7 PFAM
Pfam:AAA 19 110 3.1e-5 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,293,811 S1122P probably benign Het
Alpk2 T C 18: 65,289,738 Y1963C probably benign Het
Bptf T A 11: 107,111,126 N387Y probably damaging Het
C1ql2 T C 1: 120,341,611 L165P probably damaging Het
Col5a2 C A 1: 45,376,778 C1403F probably damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Htr3a G T 9: 48,901,055 Y250* probably null Het
Ighg2c T C 12: 113,288,651 K94E unknown Het
Ighg3 T C 12: 113,360,150 N206S unknown Het
Il1f5 A G 2: 24,281,353 Y151C probably damaging Het
Kif22 G A 7: 127,033,203 R312C probably damaging Het
Lap3 T A 5: 45,511,925 V472E probably damaging Het
Mast3 T C 8: 70,782,128 T762A probably benign Het
Mfsd12 T C 10: 81,362,233 probably null Het
Mrpl39 T C 16: 84,732,385 K123R probably benign Het
Mup8 T A 4: 60,220,394 T113S possibly damaging Het
Nhp2 T C 11: 51,619,903 V29A probably benign Het
Olfr307 T C 7: 86,336,069 E109G possibly damaging Het
Pex3 T C 10: 13,546,368 R63G probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Rims2 T C 15: 39,452,328 S617P probably damaging Het
Rnf223 A T 4: 156,132,359 T64S probably damaging Het
Rrp12 C T 19: 41,883,742 V432M probably damaging Het
Sag T C 1: 87,814,806 V100A probably benign Het
Slc17a7 C T 7: 45,169,926 A167V probably benign Het
Slc38a6 T C 12: 73,310,175 F115S probably damaging Het
Spdye4a T C 5: 143,225,699 T37A probably benign Het
Sphk2 T C 7: 45,712,600 T138A possibly damaging Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Sult1a1 T C 7: 126,673,184 probably null Het
Tmem212 A G 3: 27,884,839 V166A probably benign Het
Trim43c A T 9: 88,840,414 T38S probably benign Het
Tshz1 C A 18: 84,015,966 V106F possibly damaging Het
Yap1 A G 9: 7,962,372 M225T possibly damaging Het
Zcchc11 G T 4: 108,558,782 E1648D probably damaging Het
Zfp74 T C 7: 29,935,623 E220G probably damaging Het
Other mutations in Tor4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02138:Tor4a APN 2 25194798 missense probably benign 0.18
IGL02813:Tor4a APN 2 25194749 nonsense probably null
R1486:Tor4a UTSW 2 25194679 missense possibly damaging 0.47
R1916:Tor4a UTSW 2 25195402 missense possibly damaging 0.83
R2958:Tor4a UTSW 2 25194968 missense possibly damaging 0.93
R5237:Tor4a UTSW 2 25194964 missense probably damaging 0.97
R5356:Tor4a UTSW 2 25195906 intron probably null
R5694:Tor4a UTSW 2 25194920 missense probably benign
R5874:Tor4a UTSW 2 25194835 missense probably damaging 1.00
R6314:Tor4a UTSW 2 25194782 missense possibly damaging 0.86
R7056:Tor4a UTSW 2 25194841 missense probably benign
R7498:Tor4a UTSW 2 25195792 missense probably benign 0.22
R7590:Tor4a UTSW 2 25195798 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CATGGTAGTAGCTGAGCTGC -3'
(R):5'- GATGAGGCTGAACTCTTGCCAC -3'

Sequencing Primer
(F):5'- TGCCAGATGTTCTGCCAG -3'
(R):5'- ACCTGCGCTGCTAGATGAG -3'
Posted On2018-05-04