Incidental Mutation 'R6429:Msr1'
ID 518434
Institutional Source Beutler Lab
Gene Symbol Msr1
Ensembl Gene ENSMUSG00000025044
Gene Name macrophage scavenger receptor 1
Synonyms SR-AI, MSR-A, SR-AII, Scara1, Scvr, MRS-A
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001113326; MGI:98257

Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R6429 (G1)
Quality Score 209.009
Status Not validated
Chromosome 8
Chromosomal Location 39581685-39642673 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 39615817 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 213 (P213S)
Ref Sequence ENSEMBL: ENSMUSP00000147644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026021] [ENSMUST00000170091] [ENSMUST00000210525]
AlphaFold P30204
Predicted Effect probably damaging
Transcript: ENSMUST00000026021
AA Change: P279S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026021
Gene: ENSMUSG00000025044
AA Change: P279S

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
Pfam:Macscav_rec 125 173 1.5e-28 PFAM
coiled coil region 209 259 N/A INTRINSIC
Pfam:Collagen 275 330 3.2e-11 PFAM
Pfam:Collagen 295 353 4.8e-10 PFAM
SR 357 457 5.68e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170091
AA Change: P279S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132535
Gene: ENSMUSG00000025044
AA Change: P279S

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
Pfam:Macscav_rec 125 173 6.6e-34 PFAM
Pfam:Collagen 275 330 1.9e-10 PFAM
Pfam:Collagen 292 352 7.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210525
AA Change: P213S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the class A macrophage scavenger receptors, which include three different types (1, 2, 3) generated by alternative splicing of this gene. These receptors or isoforms are macrophage-specific trimeric integral membrane glycoproteins and have been implicated in many macrophage-associated physiological and pathological processes including atherosclerosis, Alzheimer's disease, and host defense. The isoforms type 1 and type 2 are functional receptors and are able to mediate the endocytosis of modified low density lipoproteins (LDLs). The isoform type 3 does not internalize modified LDL (acetyl-LDL) despite having the domain shown to mediate this function in the types 1 and 2 isoforms. It has an altered intracellular processing and is trapped within the endoplasmic reticulum, making it unable to perform endocytosis. The isoform type 3 can inhibit the function of isoforms type 1 and type 2 when co-expressed, indicating a dominant negative effect and suggesting a mechanism for regulation of scavenger receptor activity in macrophages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal uptake and degradation of acetylated low density lipoproteins by macrophages, increased interleukin-12 secretion in response to CpG oligodeoxynucleotide administration, and increased bacterial and viral infection induced morbidity/mortality. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik T C 7: 127,385,042 probably benign Het
Acacb G A 5: 114,228,591 E1565K probably damaging Het
Amy1 T C 3: 113,569,509 N63S probably damaging Het
Arhgef15 G T 11: 68,947,796 N591K probably damaging Het
AW551984 A G 9: 39,600,614 S34P probably damaging Het
C2cd3 A G 7: 100,432,091 D127G probably damaging Het
Ccdc87 T A 19: 4,841,235 V585E probably benign Het
Cul2 T C 18: 3,421,345 I223T probably damaging Het
Dgkq C T 5: 108,653,708 V495M probably damaging Het
Dpp10 A G 1: 123,367,601 I570T possibly damaging Het
Dstyk C T 1: 132,449,804 Q383* probably null Het
Emilin2 C A 17: 71,310,956 probably benign Het
Fnip1 A G 11: 54,515,567 I1163M probably damaging Het
Fryl C T 5: 73,090,751 E1008K possibly damaging Het
Gm15448 A T 7: 3,822,346 H432Q possibly damaging Het
Gm35315 A T 5: 110,078,659 Y305N possibly damaging Het
Grhl3 T A 4: 135,557,196 D195V probably damaging Het
Il33 T C 19: 29,952,000 F41S probably benign Het
Il4 A G 11: 53,613,909 S15P possibly damaging Het
Inf2 C T 12: 112,604,256 P410S probably benign Het
Kalrn T A 16: 34,332,164 D349V possibly damaging Het
Krt4 A G 15: 101,922,794 M224T probably benign Het
Lrp2 C T 2: 69,461,287 S3516N probably damaging Het
Macf1 A T 4: 123,401,594 probably null Het
Nptx1 G T 11: 119,544,721 C256* probably null Het
Nr1d1 T C 11: 98,772,014 Y51C probably damaging Het
Olfr1205 G A 2: 88,831,525 R136Q probably benign Het
Panx3 T C 9: 37,661,165 D363G probably damaging Het
Prkag1 A G 15: 98,814,523 F143L probably damaging Het
Ptger4 T C 15: 5,242,997 K72R possibly damaging Het
Pvrig A G 5: 138,342,050 T28A probably benign Het
Rhod C T 19: 4,426,105 C206Y probably benign Het
Rngtt C A 4: 33,320,606 S51* probably null Het
Rreb1 T G 13: 37,932,129 S1155A probably benign Het
Scn9a A C 2: 66,526,963 I998S possibly damaging Het
Sfmbt1 T A 14: 30,773,911 F50L probably damaging Het
Six4 A T 12: 73,103,473 V766D probably damaging Het
Smpd1 T C 7: 105,556,928 I421T probably damaging Het
Son T A 16: 91,658,166 M1267K probably benign Het
Styk1 T A 6: 131,310,064 D156V possibly damaging Het
Supt3 A G 17: 45,119,143 E361G probably benign Het
Tbx3 T A 5: 119,674,191 Y185* probably null Het
Tmem2 T C 19: 21,801,908 C361R probably benign Het
Trpm1 A T 7: 64,268,504 T531S probably benign Het
Tspan32 T A 7: 143,018,742 W172R possibly damaging Het
Ttc26 T A 6: 38,398,313 S250T possibly damaging Het
Urb1 A T 16: 90,762,430 probably null Het
Vmn2r70 T A 7: 85,559,068 I734F probably damaging Het
Vwa7 A G 17: 35,024,199 T618A probably benign Het
Wac T A 18: 7,920,163 V339E probably damaging Het
Wrn G A 8: 33,342,996 T156M probably damaging Het
Zeb1 T A 18: 5,770,498 C884S probably damaging Het
Zmpste24 A G 4: 121,095,670 V10A probably damaging Het
Other mutations in Msr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Msr1 APN 8 39611673 missense probably benign 0.42
IGL02047:Msr1 APN 8 39623960 missense probably benign 0.03
IGL02218:Msr1 APN 8 39589316 missense possibly damaging 0.51
IGL02347:Msr1 APN 8 39632737 missense probably damaging 1.00
IGL02546:Msr1 APN 8 39615747 missense probably benign
IGL02707:Msr1 APN 8 39632829 splice site probably benign
IGL03340:Msr1 APN 8 39620007 missense possibly damaging 0.53
R0349:Msr1 UTSW 8 39581827 missense probably damaging 1.00
R0378:Msr1 UTSW 8 39589382 missense possibly damaging 0.92
R0633:Msr1 UTSW 8 39620000 missense probably damaging 0.99
R1386:Msr1 UTSW 8 39589293 nonsense probably null
R1807:Msr1 UTSW 8 39619907 missense probably benign 0.33
R2039:Msr1 UTSW 8 39589377 missense probably damaging 1.00
R2174:Msr1 UTSW 8 39631340 missense probably damaging 1.00
R2291:Msr1 UTSW 8 39624222 missense probably benign 0.03
R3983:Msr1 UTSW 8 39620018 missense possibly damaging 0.89
R4807:Msr1 UTSW 8 39642627 start gained probably benign
R4921:Msr1 UTSW 8 39624251 missense possibly damaging 0.72
R5055:Msr1 UTSW 8 39623956 missense possibly damaging 0.78
R5567:Msr1 UTSW 8 39611719 missense probably benign
R5570:Msr1 UTSW 8 39611719 missense probably benign
R5871:Msr1 UTSW 8 39611652 missense probably damaging 0.97
R5914:Msr1 UTSW 8 39581827 missense probably damaging 1.00
R6141:Msr1 UTSW 8 39631319 missense probably damaging 1.00
R6519:Msr1 UTSW 8 39624221 missense probably benign
R6527:Msr1 UTSW 8 39624233 missense possibly damaging 0.72
R6842:Msr1 UTSW 8 39632825 missense probably benign 0.01
R7006:Msr1 UTSW 8 39589382 missense probably damaging 0.99
R7047:Msr1 UTSW 8 39642616 missense possibly damaging 0.92
R7135:Msr1 UTSW 8 39589424 missense possibly damaging 0.93
R7552:Msr1 UTSW 8 39623962 missense probably benign 0.19
R7837:Msr1 UTSW 8 39581832 missense probably damaging 0.99
R8995:Msr1 UTSW 8 39589419 missense possibly damaging 0.54
R9707:Msr1 UTSW 8 39623947 missense probably benign 0.06
R9723:Msr1 UTSW 8 39589316 missense possibly damaging 0.51
Z1177:Msr1 UTSW 8 39631302 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACCTCACATTGTAACTCTGG -3'
(R):5'- ACTGGTCTACTTGACTACATGATC -3'

Sequencing Primer
(F):5'- TAGAGGACCCATGCATGATTCCTG -3'
(R):5'- GGTCTACTTGACTACATGATCTACAG -3'
Posted On 2018-05-24