Incidental Mutation 'R6519:Msr1'
ID521009
Institutional Source Beutler Lab
Gene Symbol Msr1
Ensembl Gene ENSMUSG00000025044
Gene Namemacrophage scavenger receptor 1
SynonymsSR-AI, MSR-A, SR-AII, Scara1, Scvr, MRS-A
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001113326; MGI:98257

Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6519 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location39581685-39642673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39624221 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 116 (T116I)
Ref Sequence ENSEMBL: ENSMUSP00000132535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026021] [ENSMUST00000170091] [ENSMUST00000210525]
Predicted Effect probably benign
Transcript: ENSMUST00000026021
AA Change: T116I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026021
Gene: ENSMUSG00000025044
AA Change: T116I

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
Pfam:Macscav_rec 125 173 1.5e-28 PFAM
coiled coil region 209 259 N/A INTRINSIC
Pfam:Collagen 275 330 3.2e-11 PFAM
Pfam:Collagen 295 353 4.8e-10 PFAM
SR 357 457 5.68e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170091
AA Change: T116I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132535
Gene: ENSMUSG00000025044
AA Change: T116I

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
Pfam:Macscav_rec 125 173 6.6e-34 PFAM
Pfam:Collagen 275 330 1.9e-10 PFAM
Pfam:Collagen 292 352 7.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210681
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the class A macrophage scavenger receptors, which include three different types (1, 2, 3) generated by alternative splicing of this gene. These receptors or isoforms are macrophage-specific trimeric integral membrane glycoproteins and have been implicated in many macrophage-associated physiological and pathological processes including atherosclerosis, Alzheimer's disease, and host defense. The isoforms type 1 and type 2 are functional receptors and are able to mediate the endocytosis of modified low density lipoproteins (LDLs). The isoform type 3 does not internalize modified LDL (acetyl-LDL) despite having the domain shown to mediate this function in the types 1 and 2 isoforms. It has an altered intracellular processing and is trapped within the endoplasmic reticulum, making it unable to perform endocytosis. The isoform type 3 can inhibit the function of isoforms type 1 and type 2 when co-expressed, indicating a dominant negative effect and suggesting a mechanism for regulation of scavenger receptor activity in macrophages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal uptake and degradation of acetylated low density lipoproteins by macrophages, increased interleukin-12 secretion in response to CpG oligodeoxynucleotide administration, and increased bacterial and viral infection induced morbidity/mortality. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Aldob A T 4: 49,543,835 V49E probably damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
BC037034 A G 5: 138,261,848 S344P probably damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dclre1c T C 2: 3,429,329 Y75H probably damaging Het
Dhx35 A T 2: 158,831,710 I354F probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnase1 A T 16: 4,038,589 S132C probably damaging Het
Dnttip2 T C 3: 122,275,471 S112P probably benign Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glb1l T C 1: 75,201,056 D406G probably benign Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdac2 T A 10: 36,989,256 N155K probably damaging Het
Hus1b A G 13: 30,946,947 I243T probably benign Het
Kcnab2 T C 4: 152,411,993 T65A probably damaging Het
Lasp1 T A 11: 97,815,557 probably null Het
Lrch3 G A 16: 32,994,997 probably benign Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Nup160 A C 2: 90,718,217 R1037S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr32 A T 2: 90,138,812 I109N possibly damaging Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rdh11 T A 12: 79,182,815 H228L probably damaging Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Txnrd3 T C 6: 89,654,423 probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zfp955b T A 17: 33,302,077 S173R possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in Msr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Msr1 APN 8 39611673 missense probably benign 0.42
IGL02047:Msr1 APN 8 39623960 missense probably benign 0.03
IGL02218:Msr1 APN 8 39589316 missense possibly damaging 0.51
IGL02347:Msr1 APN 8 39632737 missense probably damaging 1.00
IGL02546:Msr1 APN 8 39615747 missense probably benign
IGL02707:Msr1 APN 8 39632829 splice site probably benign
IGL03340:Msr1 APN 8 39620007 missense possibly damaging 0.53
R0349:Msr1 UTSW 8 39581827 missense probably damaging 1.00
R0378:Msr1 UTSW 8 39589382 missense possibly damaging 0.92
R0633:Msr1 UTSW 8 39620000 missense probably damaging 0.99
R1386:Msr1 UTSW 8 39589293 nonsense probably null
R1807:Msr1 UTSW 8 39619907 missense probably benign 0.33
R2039:Msr1 UTSW 8 39589377 missense probably damaging 1.00
R2174:Msr1 UTSW 8 39631340 missense probably damaging 1.00
R2291:Msr1 UTSW 8 39624222 missense probably benign 0.03
R3983:Msr1 UTSW 8 39620018 missense possibly damaging 0.89
R4807:Msr1 UTSW 8 39642627 start gained probably benign
R4921:Msr1 UTSW 8 39624251 missense possibly damaging 0.72
R5055:Msr1 UTSW 8 39623956 missense possibly damaging 0.78
R5567:Msr1 UTSW 8 39611719 missense probably benign
R5570:Msr1 UTSW 8 39611719 missense probably benign
R5871:Msr1 UTSW 8 39611652 missense probably damaging 0.97
R5914:Msr1 UTSW 8 39581827 missense probably damaging 1.00
R6141:Msr1 UTSW 8 39631319 missense probably damaging 1.00
R6429:Msr1 UTSW 8 39615817 missense probably damaging 0.99
R6527:Msr1 UTSW 8 39624233 missense possibly damaging 0.72
R6842:Msr1 UTSW 8 39632825 missense probably benign 0.01
R7006:Msr1 UTSW 8 39589382 missense probably damaging 0.99
R7047:Msr1 UTSW 8 39642616 missense possibly damaging 0.92
R7135:Msr1 UTSW 8 39589424 missense possibly damaging 0.93
R7552:Msr1 UTSW 8 39623962 missense probably benign 0.19
R7837:Msr1 UTSW 8 39581832 missense probably damaging 0.99
R7920:Msr1 UTSW 8 39581832 missense probably damaging 0.99
Z1177:Msr1 UTSW 8 39631302 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGAGATTGCATCCAGTGAATTC -3'
(R):5'- TTCAATGGGTGGGATTCAAAGAC -3'

Sequencing Primer
(F):5'- GAGATTGCATCCAGTGAATTCCCATG -3'
(R):5'- TTCAAAGACATAGGGATGATGAGCAC -3'
Posted On2018-06-06