Incidental Mutation 'R6441:Rbm44'
ID519001
Institutional Source Beutler Lab
Gene Symbol Rbm44
Ensembl Gene ENSMUSG00000070732
Gene NameRNA binding motif protein 44
SynonymsLOC329207
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6441 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location91145089-91170795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91157077 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 674 (N674Y)
Ref Sequence ENSEMBL: ENSMUSP00000092286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094698] [ENSMUST00000188818]
Predicted Effect probably damaging
Transcript: ENSMUST00000094698
AA Change: N674Y

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092286
Gene: ENSMUSG00000070732
AA Change: N674Y

DomainStartEndE-ValueType
low complexity region 227 238 N/A INTRINSIC
low complexity region 444 460 N/A INTRINSIC
RRM 793 861 8.27e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188818
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous or heterozygous for a knock-out allele exhibit enhanced fertility with increased litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,771,459 M1047K probably benign Het
Apob A T 12: 7,987,796 D322V probably damaging Het
Capn12 T A 7: 28,888,002 C438S probably benign Het
Cdh23 A T 10: 60,308,036 V2932E probably damaging Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
CN725425 T C 15: 91,235,802 V42A probably benign Het
Cpb1 T C 3: 20,249,814 D362G probably damaging Het
Csmd2 C A 4: 128,394,964 Q1099K probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Galnt4 A G 10: 99,110,098 M562V possibly damaging Het
Gtf3c3 T A 1: 54,406,038 E619V probably benign Het
Gucy2c A T 6: 136,723,761 M585K probably damaging Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Lonrf2 T C 1: 38,818,123 E44G possibly damaging Het
Lrit3 A T 3: 129,800,360 F189L probably benign Het
Mag T C 7: 30,907,083 N310D possibly damaging Het
Mccc2 T C 13: 99,954,676 T151A probably damaging Het
Mybpc1 A T 10: 88,553,277 S49T probably benign Het
Myh2 A G 11: 67,194,611 E1787G probably benign Het
Ncapd3 A G 9: 27,063,416 D728G probably benign Het
Nup37 A G 10: 88,160,937 E139G probably benign Het
Odf3 T C 7: 140,849,248 S149P probably damaging Het
Olfr651 C T 7: 104,553,335 Q139* probably null Het
Pcdhgb5 A G 18: 37,732,085 Y311C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Ryr1 T C 7: 29,059,695 I3353V possibly damaging Het
Sema3c C T 5: 17,724,132 T588I possibly damaging Het
Sh2d5 A T 4: 138,259,082 E372V possibly damaging Het
Slc27a6 C T 18: 58,572,058 P171S probably benign Het
Slfn3 C T 11: 83,214,914 T579I probably benign Het
Svil T G 18: 5,049,323 V287G probably benign Het
Tas1r2 T A 4: 139,669,156 V602D probably damaging Het
Tln2 A G 9: 67,272,689 L800P probably damaging Het
Trim31 C A 17: 36,907,791 Q323K possibly damaging Het
Txndc9 T A 1: 37,990,218 D183V possibly damaging Het
Vmn2r28 T A 7: 5,488,475 M258L probably benign Het
Vmn2r75 A T 7: 86,171,576 I50N probably damaging Het
Zgrf1 A T 3: 127,588,034 N1161Y possibly damaging Het
Other mutations in Rbm44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rbm44 APN 1 91157109 missense probably benign
IGL01089:Rbm44 APN 1 91168697 missense possibly damaging 0.61
IGL01339:Rbm44 APN 1 91168964 missense probably benign 0.45
IGL01410:Rbm44 APN 1 91168829 missense probably benign 0.01
IGL01624:Rbm44 APN 1 91156658 missense probably damaging 0.96
IGL01963:Rbm44 APN 1 91163108 missense probably benign 0.00
IGL02067:Rbm44 APN 1 91152845 missense probably damaging 0.98
IGL02513:Rbm44 APN 1 91155538 missense possibly damaging 0.63
IGL02804:Rbm44 APN 1 91150176 intron probably benign
IGL02806:Rbm44 APN 1 91153077 missense possibly damaging 0.79
IGL02887:Rbm44 APN 1 91153180 missense probably damaging 1.00
IGL03309:Rbm44 APN 1 91168840 critical splice donor site probably null
R0360:Rbm44 UTSW 1 91152347 missense probably benign 0.01
R0364:Rbm44 UTSW 1 91152347 missense probably benign 0.01
R0647:Rbm44 UTSW 1 91156928 missense probably benign 0.00
R1345:Rbm44 UTSW 1 91152759 missense probably damaging 0.99
R1352:Rbm44 UTSW 1 91153042 missense probably damaging 1.00
R1575:Rbm44 UTSW 1 91156843 splice site probably null
R1768:Rbm44 UTSW 1 91153957 splice site probably null
R4901:Rbm44 UTSW 1 91153328 missense probably benign 0.13
R4913:Rbm44 UTSW 1 91155494 missense probably damaging 1.00
R5023:Rbm44 UTSW 1 91169098 critical splice donor site probably null
R5569:Rbm44 UTSW 1 91168738 missense probably damaging 0.99
R5874:Rbm44 UTSW 1 91156840 critical splice donor site probably null
R5981:Rbm44 UTSW 1 91152689 missense possibly damaging 0.61
R6515:Rbm44 UTSW 1 91165138 missense probably damaging 0.96
R7380:Rbm44 UTSW 1 91152216 missense possibly damaging 0.77
R7783:Rbm44 UTSW 1 91168829 missense probably benign 0.01
R8004:Rbm44 UTSW 1 91152158 splice site probably benign
R8678:Rbm44 UTSW 1 91152381 missense probably damaging 1.00
R8891:Rbm44 UTSW 1 91162414 missense probably benign 0.12
Z1176:Rbm44 UTSW 1 91153400 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGGTACGTATGTGTTCTAG -3'
(R):5'- CAGGTCTGCTTCGACAAGTG -3'

Sequencing Primer
(F):5'- GGTACGTATGTGTTCTAGAATGAAAC -3'
(R):5'- GACAAGTGTCCTCTCACCCTGG -3'
Posted On2018-05-24