Incidental Mutation 'R6441:Capn12'
ID519014
Institutional Source Beutler Lab
Gene Symbol Capn12
Ensembl Gene ENSMUSG00000054083
Gene Namecalpain 12
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001110807.1; MGI: 1891369

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6441 (G1)
Quality Score163.009
Status Not validated
Chromosome7
Chromosomal Location28881422-28893563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28888002 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 438 (C438S)
Ref Sequence ENSEMBL: ENSMUSP00000069055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066880]
Predicted Effect probably benign
Transcript: ENSMUST00000066880
AA Change: C438S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000069055
Gene: ENSMUSG00000054083
AA Change: C438S

DomainStartEndE-ValueType
CysPc 27 349 7.8e-139 SMART
calpain_III 353 529 7.47e-72 SMART
SCOP:d1alva_ 552 720 3e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208299
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes a member of the calpain large subunit family. [provided by RefSeq, Jun 2012]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,771,459 M1047K probably benign Het
Apob A T 12: 7,987,796 D322V probably damaging Het
Cdh23 A T 10: 60,308,036 V2932E probably damaging Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
CN725425 T C 15: 91,235,802 V42A probably benign Het
Cpb1 T C 3: 20,249,814 D362G probably damaging Het
Csmd2 C A 4: 128,394,964 Q1099K probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Galnt4 A G 10: 99,110,098 M562V possibly damaging Het
Gtf3c3 T A 1: 54,406,038 E619V probably benign Het
Gucy2c A T 6: 136,723,761 M585K probably damaging Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Lonrf2 T C 1: 38,818,123 E44G possibly damaging Het
Lrit3 A T 3: 129,800,360 F189L probably benign Het
Mag T C 7: 30,907,083 N310D possibly damaging Het
Mccc2 T C 13: 99,954,676 T151A probably damaging Het
Mybpc1 A T 10: 88,553,277 S49T probably benign Het
Myh2 A G 11: 67,194,611 E1787G probably benign Het
Ncapd3 A G 9: 27,063,416 D728G probably benign Het
Nup37 A G 10: 88,160,937 E139G probably benign Het
Odf3 T C 7: 140,849,248 S149P probably damaging Het
Olfr651 C T 7: 104,553,335 Q139* probably null Het
Pcdhgb5 A G 18: 37,732,085 Y311C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rbm44 A T 1: 91,157,077 N674Y probably damaging Het
Ryr1 T C 7: 29,059,695 I3353V possibly damaging Het
Sema3c C T 5: 17,724,132 T588I possibly damaging Het
Sh2d5 A T 4: 138,259,082 E372V possibly damaging Het
Slc27a6 C T 18: 58,572,058 P171S probably benign Het
Slfn3 C T 11: 83,214,914 T579I probably benign Het
Svil T G 18: 5,049,323 V287G probably benign Het
Tas1r2 T A 4: 139,669,156 V602D probably damaging Het
Tln2 A G 9: 67,272,689 L800P probably damaging Het
Trim31 C A 17: 36,907,791 Q323K possibly damaging Het
Txndc9 T A 1: 37,990,218 D183V possibly damaging Het
Vmn2r28 T A 7: 5,488,475 M258L probably benign Het
Vmn2r75 A T 7: 86,171,576 I50N probably damaging Het
Zgrf1 A T 3: 127,588,034 N1161Y possibly damaging Het
Other mutations in Capn12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01717:Capn12 APN 7 28889105 missense probably benign
IGL01758:Capn12 APN 7 28886623 splice site probably null
IGL02381:Capn12 APN 7 28886455 splice site probably benign
IGL02863:Capn12 APN 7 28883156 missense probably damaging 1.00
IGL03237:Capn12 APN 7 28890941 missense probably damaging 1.00
PIT4418001:Capn12 UTSW 7 28886536 missense probably benign 0.06
R0027:Capn12 UTSW 7 28881960 missense probably benign 0.01
R0047:Capn12 UTSW 7 28890387 critical splice donor site probably null
R0047:Capn12 UTSW 7 28890387 critical splice donor site probably null
R0070:Capn12 UTSW 7 28889126 unclassified probably benign
R0070:Capn12 UTSW 7 28889126 unclassified probably benign
R0533:Capn12 UTSW 7 28887683 missense possibly damaging 0.48
R0932:Capn12 UTSW 7 28887698 missense possibly damaging 0.91
R1524:Capn12 UTSW 7 28882764 splice site probably benign
R4758:Capn12 UTSW 7 28892723 missense possibly damaging 0.66
R4793:Capn12 UTSW 7 28892669 missense probably benign 0.23
R4983:Capn12 UTSW 7 28890370 missense probably benign 0.00
R5560:Capn12 UTSW 7 28882860 missense probably benign 0.01
R5835:Capn12 UTSW 7 28881958 missense probably benign 0.05
R5886:Capn12 UTSW 7 28887605 missense probably benign 0.01
R6247:Capn12 UTSW 7 28888652 missense probably benign 0.05
R7136:Capn12 UTSW 7 28883107 splice site probably null
R7757:Capn12 UTSW 7 28882821 missense probably damaging 1.00
R8329:Capn12 UTSW 7 28883201 missense probably damaging 1.00
R8924:Capn12 UTSW 7 28883203 missense probably damaging 1.00
Z1177:Capn12 UTSW 7 28887828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAACTTGGGTGAGGCTTG -3'
(R):5'- TTCTCCAATGATATCTGCAGTGG -3'

Sequencing Primer
(F):5'- TGTGGCAGGATGGGAACTCC -3'
(R):5'- GCAGTGGCACTCCTCTTTGAAC -3'
Posted On2018-05-24