Incidental Mutation 'R6441:Lonrf2'
ID518999
Institutional Source Beutler Lab
Gene Symbol Lonrf2
Ensembl Gene ENSMUSG00000048814
Gene NameLON peptidase N-terminal domain and ring finger 2
Synonyms2900060P06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6441 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location38793645-38836711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38818123 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 44 (E44G)
Ref Sequence ENSEMBL: ENSMUSP00000117600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039612] [ENSMUST00000147695]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039612
AA Change: E44G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047372
Gene: ENSMUSG00000048814
AA Change: E44G

DomainStartEndE-ValueType
Blast:TPR 22 55 2e-14 BLAST
low complexity region 72 87 N/A INTRINSIC
RING 213 250 1.54e-5 SMART
Pfam:LON 301 498 4.1e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000147695
AA Change: E44G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117600
Gene: ENSMUSG00000048814
AA Change: E44G

DomainStartEndE-ValueType
Blast:TPR 22 55 2e-14 BLAST
low complexity region 72 87 N/A INTRINSIC
RING 213 250 1.54e-5 SMART
Pfam:LON_substr_bdg 301 498 2.6e-27 PFAM
Meta Mutation Damage Score 0.1144 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,771,459 M1047K probably benign Het
Apob A T 12: 7,987,796 D322V probably damaging Het
Capn12 T A 7: 28,888,002 C438S probably benign Het
Cdh23 A T 10: 60,308,036 V2932E probably damaging Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
CN725425 T C 15: 91,235,802 V42A probably benign Het
Cpb1 T C 3: 20,249,814 D362G probably damaging Het
Csmd2 C A 4: 128,394,964 Q1099K probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Galnt4 A G 10: 99,110,098 M562V possibly damaging Het
Gtf3c3 T A 1: 54,406,038 E619V probably benign Het
Gucy2c A T 6: 136,723,761 M585K probably damaging Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Lrit3 A T 3: 129,800,360 F189L probably benign Het
Mag T C 7: 30,907,083 N310D possibly damaging Het
Mccc2 T C 13: 99,954,676 T151A probably damaging Het
Mybpc1 A T 10: 88,553,277 S49T probably benign Het
Myh2 A G 11: 67,194,611 E1787G probably benign Het
Ncapd3 A G 9: 27,063,416 D728G probably benign Het
Nup37 A G 10: 88,160,937 E139G probably benign Het
Odf3 T C 7: 140,849,248 S149P probably damaging Het
Olfr651 C T 7: 104,553,335 Q139* probably null Het
Pcdhgb5 A G 18: 37,732,085 Y311C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rbm44 A T 1: 91,157,077 N674Y probably damaging Het
Ryr1 T C 7: 29,059,695 I3353V possibly damaging Het
Sema3c C T 5: 17,724,132 T588I possibly damaging Het
Sh2d5 A T 4: 138,259,082 E372V possibly damaging Het
Slc27a6 C T 18: 58,572,058 P171S probably benign Het
Slfn3 C T 11: 83,214,914 T579I probably benign Het
Svil T G 18: 5,049,323 V287G probably benign Het
Tas1r2 T A 4: 139,669,156 V602D probably damaging Het
Tln2 A G 9: 67,272,689 L800P probably damaging Het
Trim31 C A 17: 36,907,791 Q323K possibly damaging Het
Txndc9 T A 1: 37,990,218 D183V possibly damaging Het
Vmn2r28 T A 7: 5,488,475 M258L probably benign Het
Vmn2r75 A T 7: 86,171,576 I50N probably damaging Het
Zgrf1 A T 3: 127,588,034 N1161Y possibly damaging Het
Other mutations in Lonrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Lonrf2 APN 1 38812535 splice site probably benign
IGL02369:Lonrf2 APN 1 38811832 splice site probably benign
IGL02526:Lonrf2 APN 1 38800710 missense probably benign 0.02
gorged UTSW 1 38804336 missense probably benign 0.05
Swollen UTSW 1 38813389 missense probably benign
R1450:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1527:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1541:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1655:Lonrf2 UTSW 1 38811824 missense probably damaging 0.98
R1679:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1681:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1711:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1732:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1758:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1768:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1795:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1831:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1832:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1833:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R2044:Lonrf2 UTSW 1 38807050 missense probably benign 0.17
R2054:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R2656:Lonrf2 UTSW 1 38815960 splice site probably null
R4084:Lonrf2 UTSW 1 38821151 missense probably benign 0.00
R4775:Lonrf2 UTSW 1 38818059 splice site probably null
R4796:Lonrf2 UTSW 1 38816038 missense probably benign 0.00
R5445:Lonrf2 UTSW 1 38807153 missense probably benign 0.05
R5875:Lonrf2 UTSW 1 38807047 missense probably benign 0.01
R5902:Lonrf2 UTSW 1 38807093 missense probably benign 0.17
R6533:Lonrf2 UTSW 1 38813268 missense probably benign 0.08
R6695:Lonrf2 UTSW 1 38813389 missense probably benign
R6930:Lonrf2 UTSW 1 38804336 missense probably benign 0.05
R7923:Lonrf2 UTSW 1 38800762 missense probably benign 0.30
R8237:Lonrf2 UTSW 1 38800773 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTACACCGTCACAGGCATTTG -3'
(R):5'- CAGTGAAGCTTGCCAGTTATC -3'

Sequencing Primer
(F):5'- CCGTCACAGGCATTTGAAATCATG -3'
(R):5'- GCTTGCCAGTTATCAAGACG -3'
Posted On2018-05-24