Incidental Mutation 'R6441:Tas1r2'
ID519009
Institutional Source Beutler Lab
Gene Symbol Tas1r2
Ensembl Gene ENSMUSG00000028738
Gene Nametaste receptor, type 1, member 2
SynonymsGpr71, TR2, T1r2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6441 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location139653538-139670280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139669156 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 602 (V602D)
Ref Sequence ENSEMBL: ENSMUSP00000127737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030510] [ENSMUST00000166773]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030510
AA Change: V631D

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030510
Gene: ENSMUSG00000028738
AA Change: V631D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 73 459 2e-90 PFAM
Pfam:NCD3G 495 548 2.4e-17 PFAM
Pfam:7tm_3 581 818 2.8e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166773
AA Change: V602D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127737
Gene: ENSMUSG00000028738
AA Change: V602D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 73 213 5.3e-38 PFAM
Pfam:ANF_receptor 217 429 8.4e-31 PFAM
Pfam:NCD3G 466 519 7.4e-19 PFAM
Pfam:7tm_3 550 790 3e-47 PFAM
Meta Mutation Damage Score 0.1300 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice show diminished behavioral and nervous responses to sweet tastants. Response to umami tastants is unimpaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,771,459 M1047K probably benign Het
Apob A T 12: 7,987,796 D322V probably damaging Het
Capn12 T A 7: 28,888,002 C438S probably benign Het
Cdh23 A T 10: 60,308,036 V2932E probably damaging Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
CN725425 T C 15: 91,235,802 V42A probably benign Het
Cpb1 T C 3: 20,249,814 D362G probably damaging Het
Csmd2 C A 4: 128,394,964 Q1099K probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Galnt4 A G 10: 99,110,098 M562V possibly damaging Het
Gtf3c3 T A 1: 54,406,038 E619V probably benign Het
Gucy2c A T 6: 136,723,761 M585K probably damaging Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Lonrf2 T C 1: 38,818,123 E44G possibly damaging Het
Lrit3 A T 3: 129,800,360 F189L probably benign Het
Mag T C 7: 30,907,083 N310D possibly damaging Het
Mccc2 T C 13: 99,954,676 T151A probably damaging Het
Mybpc1 A T 10: 88,553,277 S49T probably benign Het
Myh2 A G 11: 67,194,611 E1787G probably benign Het
Ncapd3 A G 9: 27,063,416 D728G probably benign Het
Nup37 A G 10: 88,160,937 E139G probably benign Het
Odf3 T C 7: 140,849,248 S149P probably damaging Het
Olfr651 C T 7: 104,553,335 Q139* probably null Het
Pcdhgb5 A G 18: 37,732,085 Y311C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rbm44 A T 1: 91,157,077 N674Y probably damaging Het
Ryr1 T C 7: 29,059,695 I3353V possibly damaging Het
Sema3c C T 5: 17,724,132 T588I possibly damaging Het
Sh2d5 A T 4: 138,259,082 E372V possibly damaging Het
Slc27a6 C T 18: 58,572,058 P171S probably benign Het
Slfn3 C T 11: 83,214,914 T579I probably benign Het
Svil T G 18: 5,049,323 V287G probably benign Het
Tln2 A G 9: 67,272,689 L800P probably damaging Het
Trim31 C A 17: 36,907,791 Q323K possibly damaging Het
Txndc9 T A 1: 37,990,218 D183V possibly damaging Het
Vmn2r28 T A 7: 5,488,475 M258L probably benign Het
Vmn2r75 A T 7: 86,171,576 I50N probably damaging Het
Zgrf1 A T 3: 127,588,034 N1161Y possibly damaging Het
Other mutations in Tas1r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Tas1r2 APN 4 139660291 missense probably benign 0.03
IGL00952:Tas1r2 APN 4 139655252 missense probably benign 0.00
IGL00972:Tas1r2 APN 4 139660036 missense probably damaging 0.99
IGL01939:Tas1r2 APN 4 139669177 missense probably damaging 1.00
IGL02247:Tas1r2 APN 4 139669516 missense probably damaging 1.00
IGL02663:Tas1r2 APN 4 139660282 missense probably benign
IGL03155:Tas1r2 APN 4 139669156 missense possibly damaging 0.95
R0395:Tas1r2 UTSW 4 139655354 missense possibly damaging 0.86
R0798:Tas1r2 UTSW 4 139669713 missense probably damaging 1.00
R1221:Tas1r2 UTSW 4 139669125 missense probably benign 0.00
R1223:Tas1r2 UTSW 4 139660204 missense probably damaging 1.00
R1261:Tas1r2 UTSW 4 139655288 missense probably damaging 0.99
R1262:Tas1r2 UTSW 4 139655288 missense probably damaging 0.99
R1330:Tas1r2 UTSW 4 139669329 missense probably benign 0.05
R1466:Tas1r2 UTSW 4 139669411 missense probably damaging 1.00
R1466:Tas1r2 UTSW 4 139669411 missense probably damaging 1.00
R1879:Tas1r2 UTSW 4 139669695 missense probably damaging 1.00
R2112:Tas1r2 UTSW 4 139655355 missense probably benign 0.00
R2156:Tas1r2 UTSW 4 139669041 missense possibly damaging 0.79
R2509:Tas1r2 UTSW 4 139659851 missense probably damaging 1.00
R2510:Tas1r2 UTSW 4 139659851 missense probably damaging 1.00
R2511:Tas1r2 UTSW 4 139659851 missense probably damaging 1.00
R3429:Tas1r2 UTSW 4 139669575 missense probably damaging 1.00
R3430:Tas1r2 UTSW 4 139669575 missense probably damaging 1.00
R3703:Tas1r2 UTSW 4 139667418 missense probably damaging 1.00
R4105:Tas1r2 UTSW 4 139660052 missense probably benign 0.06
R4106:Tas1r2 UTSW 4 139660052 missense probably benign 0.06
R4107:Tas1r2 UTSW 4 139660052 missense probably benign 0.06
R4614:Tas1r2 UTSW 4 139659787 missense probably damaging 1.00
R4811:Tas1r2 UTSW 4 139669000 missense probably damaging 1.00
R5314:Tas1r2 UTSW 4 139655361 missense probably damaging 1.00
R5461:Tas1r2 UTSW 4 139660009 missense probably benign 0.01
R5639:Tas1r2 UTSW 4 139659796 missense probably damaging 1.00
R5703:Tas1r2 UTSW 4 139667336 missense probably damaging 1.00
R6176:Tas1r2 UTSW 4 139668888 missense probably damaging 1.00
R6297:Tas1r2 UTSW 4 139662050 missense possibly damaging 0.47
R6748:Tas1r2 UTSW 4 139669611 missense probably damaging 0.98
R6863:Tas1r2 UTSW 4 139669719 missense probably damaging 1.00
R6975:Tas1r2 UTSW 4 139669720 missense probably damaging 1.00
R7106:Tas1r2 UTSW 4 139662049 missense probably benign
R7265:Tas1r2 UTSW 4 139669652 missense probably benign 0.01
R7580:Tas1r2 UTSW 4 139659745 missense probably benign 0.05
R7651:Tas1r2 UTSW 4 139669627 missense probably benign 0.14
R8041:Tas1r2 UTSW 4 139659979 missense possibly damaging 0.65
R8530:Tas1r2 UTSW 4 139662149 missense probably benign
R8747:Tas1r2 UTSW 4 139660007 missense probably benign
R8904:Tas1r2 UTSW 4 139667403 missense probably damaging 1.00
R8906:Tas1r2 UTSW 4 139669735 missense probably damaging 1.00
Z1088:Tas1r2 UTSW 4 139660424 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAGAACAACATCGCTTGCTTC -3'
(R):5'- CCGTGATGAAGGCCACAAAG -3'

Sequencing Primer
(F):5'- ACTATCGTGGTGACCATCCTGG -3'
(R):5'- CACAAAGACGTAGGGCCCG -3'
Posted On2018-05-24