Incidental Mutation 'R6444:Mybl1'
ID519113
Institutional Source Beutler Lab
Gene Symbol Mybl1
Ensembl Gene ENSMUSG00000025912
Gene Namemyeloblastosis oncogene-like 1
SynonymsA-myb, G1-419-6, repro9
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.630) question?
Stock #R6444 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location9667415-9700209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 9685692 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 211 (P211S)
Ref Sequence ENSEMBL: ENSMUSP00000086034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088658] [ENSMUST00000115468]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088658
AA Change: P211S

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086034
Gene: ENSMUSG00000025912
AA Change: P211S

DomainStartEndE-ValueType
SANT 34 83 1.08e-18 SMART
SANT 86 135 1.26e-19 SMART
SANT 138 186 1.75e-18 SMART
Pfam:LMSTEN 240 285 1.2e-29 PFAM
Pfam:Cmyb_C 485 648 6.9e-82 PFAM
low complexity region 734 749 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115468
AA Change: P211S

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111128
Gene: ENSMUSG00000025912
AA Change: P211S

DomainStartEndE-ValueType
SANT 34 83 1.08e-18 SMART
SANT 86 135 1.26e-19 SMART
SANT 138 186 1.75e-18 SMART
Pfam:LMSTEN 239 285 1.9e-30 PFAM
Pfam:Cmyb_C 485 651 4.1e-74 PFAM
low complexity region 674 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160451
Predicted Effect unknown
Transcript: ENSMUST00000188212
AA Change: P215S
Meta Mutation Damage Score 0.0999 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Homozygous null mice of both sexes show growth retardation after birth and an impairment of serum antibody response. Male mutant mice are sterile due to a meiotic defect. While female mutant mice are fertile, breast development is impaired after pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik ACAGAGCAGTGCCTACCAG ACAG 5: 138,639,569 probably benign Het
Bcas2 T A 3: 103,172,046 probably null Het
Camk1d A T 2: 5,313,145 I233N probably damaging Het
Chd2 T C 7: 73,501,037 probably null Het
Cnot2 T C 10: 116,499,355 D246G probably benign Het
Cped1 A C 6: 21,986,931 I41L probably benign Het
Dcdc2c A G 12: 28,535,476 V174A probably damaging Het
Dscam G A 16: 96,619,644 R1681C probably damaging Het
Dysf G A 6: 84,190,840 V1755M probably benign Het
Eif5b G A 1: 38,036,211 D590N probably damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galns T C 8: 122,611,338 M1V probably null Het
Galnt15 T C 14: 32,040,411 F199L probably damaging Het
Gm8229 A T 14: 44,365,471 H38L unknown Het
Magel2 T C 7: 62,379,999 Y884H unknown Het
Miga1 A T 3: 152,283,831 V473E probably damaging Het
Mrgprx1 C T 7: 48,021,814 V62I possibly damaging Het
Myo19 A G 11: 84,895,308 H254R probably benign Het
Myo1h A G 5: 114,314,956 T6A possibly damaging Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Olfr1475 A T 19: 13,479,430 M256K possibly damaging Het
Olfr44 T C 9: 39,484,318 T309A probably benign Het
Psmd12 A G 11: 107,486,454 E113G possibly damaging Het
Ptpn3 T C 4: 57,195,730 D879G possibly damaging Het
Rufy3 A G 5: 88,637,307 Q414R probably damaging Het
Slc14a2 A G 18: 78,154,102 I813T probably damaging Het
Smok2a G T 17: 13,225,613 A26S probably benign Het
Spsb3 T A 17: 24,891,576 L459Q probably damaging Het
Tacc2 T C 7: 130,623,412 V609A possibly damaging Het
Tmem185b C A 1: 119,526,635 A42E probably damaging Het
Trim56 A G 5: 137,112,616 V682A probably damaging Het
Trim75 T C 8: 64,982,836 K321E possibly damaging Het
Ttc17 A C 2: 94,303,546 M1098R possibly damaging Het
Ydjc C A 16: 17,147,681 H136Q probably damaging Het
Zfp568 A T 7: 30,017,257 H193L probably benign Het
Znhit1 A G 5: 136,982,400 V153A probably benign Het
Other mutations in Mybl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Mybl1 APN 1 9671679 missense probably damaging 1.00
IGL01431:Mybl1 APN 1 9672647 missense probably damaging 0.97
IGL01733:Mybl1 APN 1 9685710 missense possibly damaging 0.94
IGL01903:Mybl1 APN 1 9671576 splice site probably null
IGL02527:Mybl1 APN 1 9690148 missense probably damaging 0.99
IGL02729:Mybl1 APN 1 9672570 missense probably benign 0.22
IGL02810:Mybl1 APN 1 9673115 missense probably damaging 1.00
IGL02810:Mybl1 APN 1 9678388 missense probably benign
IGL03369:Mybl1 APN 1 9672555 missense probably damaging 0.99
R0696:Mybl1 UTSW 1 9673148 missense probably damaging 1.00
R1453:Mybl1 UTSW 1 9671676 missense probably benign 0.27
R1476:Mybl1 UTSW 1 9672661 splice site probably null
R1567:Mybl1 UTSW 1 9685751 missense probably damaging 1.00
R3110:Mybl1 UTSW 1 9681870 missense probably damaging 1.00
R3112:Mybl1 UTSW 1 9681870 missense probably damaging 1.00
R3438:Mybl1 UTSW 1 9687645 missense probably damaging 1.00
R3801:Mybl1 UTSW 1 9673214 missense probably damaging 1.00
R4333:Mybl1 UTSW 1 9672298 missense probably damaging 1.00
R4646:Mybl1 UTSW 1 9672286 missense probably damaging 1.00
R4705:Mybl1 UTSW 1 9690115 missense probably damaging 0.99
R5873:Mybl1 UTSW 1 9685665 missense possibly damaging 0.75
R6326:Mybl1 UTSW 1 9678507 critical splice acceptor site probably null
R6801:Mybl1 UTSW 1 9683128 missense probably benign 0.42
R7168:Mybl1 UTSW 1 9678288 missense probably damaging 1.00
R8322:Mybl1 UTSW 1 9676281 missense probably damaging 1.00
Z1176:Mybl1 UTSW 1 9685769 missense probably damaging 0.99
Z1177:Mybl1 UTSW 1 9676040 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACGCACTATATTTCTCAATGTGG -3'
(R):5'- TAACCTCGGTGACACAAGGG -3'

Sequencing Primer
(F):5'- AATTTAAGTCTATCCATGTCACTCCC -3'
(R):5'- GGAGGGCTATTTACAAGATG -3'
Posted On2018-05-24